[zlu]

I was trying to use your MapView to look at some ELAND alignment results but didn't get very far. Since I'm new to all next generation sequencing, please excuse my ignorant questions:

1. Which ELAND alignment file should I use in the MVFmaker? I tried both the s_*_*export.txt and s_*_*_sorted.txt together with my reference genome. All I got were red x and no short reads.

2. My Solexa data comes from a paired-end sequencing of a bacterial strain. How can I input the second read?

Thank you.

[bioinfosm]

I doubt if mapviewer works for paired end data!

[griffon42]

Mapview overflow error

@baohua100

Thanks for all of your work on MapView...it's been very helpful so far and for the most part, working well.

I am having one problem that's given me some trouble. I'm using MapView to look at MAQ data aligned to the mouse genome (mm9). Using MVF splitter, I look at each chromosome individually. This works fine up to a certain base number, but once I jump to (or scroll past) around position 10000000, MapView crashes and I get an OVERFLOW ERROR.

I've tried running MapView on a number of different hardware platforms, and always encounter the same problem at the same positions.

Any advice anyone can offer would be much appreciated.

Thanks.

[WJW-Davy]

Thanks for your valuable suggestions. A new version is available. Download site: https://sites.google.com/site/wjwdavy/

Recently we are busy programming and testing. MapView is updating. Detailed manual is available later. If you have any question or suggestion, please do not hesitate to contact us.

(See MapView Home or MapView Lab)

Download Link 1: https://sites.google.com/site/wjwdav...attredirects=0





[Change Log - main versions]
3.4.0 [2009.6.1]
Run on Linux (e.g. Ubuntu 9) successfully.
Some bugs were fixed.

3.3.0 [2009.5.10]
The feature 'Overview Bar' map was added.
Double-click one line of SNP list to jump to its position not its SNP No.

3.2.0 [2009.5.7]
The bug about dealing with ambiguous nucleotides was fixed. (Note: In order to deal with ambiguous nucleotides correctly, new MVF file should be made. )
sta2txt feature was added.

3.1.4 [2009.5.2]
Text could be copyed from SNP list.
MVR file could be converted to text file. The SNP list could be exported to a flat file.

3.0 [2009.3.8]
Significant improvement.
Quality Score, Paired-end data, structure variation, coverage distribution, quality distribution, text quick view, zoom in/out, and other features were supported.

2.0 [2008.12.16]
Significant improvement.
Support many formats. Fasta format and text-based alignment results file(output by Eland, Maq, SOAP, MapNext, SeqMap … …).

1.0 [2008.11.28]
This was the first attempt.
Only support MapNext's format

[baohua100]

Now we add ZOOM IN/OUT feature to MapView

http://evolution.sysu.edu.cn/software/mapview.htm

In next week mapview can display quality score.

[seq_GA]

Hi P
I am interested to use the tool.
Please let me know whether to use eland_multi or eland_export or eland_sorted file to use as the input file?
My second question is whether I can view only solexa single run and not the pair end reads?
Thanks.

[baohua100]

Hi P
I am interested to use the tool.
Please let me know whether to use eland_multi or eland_export or eland_sorted file to use as the input file?
My second question is whether I can view only solexa single run and not the pair end reads?
Thanks.

input file:
1. Reference sequence file (contains single sequence) and
2. Eland formated alignment results file like this:
I326_2_FC306FCAAXX:8:1:211:212 GATTTATCATGTAAGAGGTTGTCATTCAGAATGGT U0 1 0 0 4 chr1 R
I326_2_FC306FCAAXX:8:1:913:158 GAAAAAGGAACCTCTGCAGACATATCATGCAACTG U0 1 0 0 164 chr1 R
I326_2_FC306FCAAXX:8:1:183:435 GGGAGATTCCCATATCTTTTCCACTTTCCTCTTCC U0 1 0 0 530 chr1 F

you can covert these 2 files to a MVF file in MapView, then open the MVF file to view results.


If the reference file or alignment results file contains multiple reference sequence id, then you can click Splitter to split the file into multiple files and one file only contains only one reference id.

[bioinfosm]

Now we add ZOOM IN/OUT feature to MapView

http://evolution.sysu.edu.cn/software/mapview.htm

In next week mapview can display quality score.

Thats great! I can see this tool becoming really useful
Some very basic things that would be wonderful are things like

- the display as SNP position centered (currently the SNP is at immediate left)
- Auto put the reads in a window to the top of the screen. Its not intuitive to see a blank screen and then scroll down to see reads there
- thresholds for reads in both directions
- zooming out further than 4, to view the bigger landscape, shaded reverse mapped reads and red-font SNPs; and then click to center at any chosen position

Good luck..

[baohua100]

The great majority of alignment viewer were designed for loading and processing big assembly file in the ACE format. This memory based design requires huge amount of memory not typically available to desktop computer users.

MapView converts the reference file and alignment result file to a single file in the MapView format (MVF). The MVF binary format, combined with effective compressing and indexing of the aligned reads, will enable reduction in disk usage and quick positioning.

MapView is a disk based viewer and it only loads displayed section of the alignment result into memory. This leads to a small burden on memory resources while not compromising the speed.

[baohua100]

To baofua100,

This must be useful !

I tried to use Mapview but I couldn't understand how to use it.

I'll be happy if you make the tutorial or the manual.

Besides, let me ask some questions.

1. Can map files of MAQ be imported to Mapview directly ?
2. Should I prepare the ref. sequence as a fasta format ?

reference :
>chr1
gaagcgtagtctagtcagcgtagtcgtaactcat

MAQ format:
I326_2_FC306FCAAXX:8:18:1354:1553 chr1 597 - 0 0 99 99 99 0 01 0 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA GGBFPOLQOPLHYRDOCLYM`OO^VSP``YR`_]T
I326_2_FC306FCAAXX:8:22:173:821 chr1 597 - 0 0 99 99 99 0 0 10 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA NHELOUPVTZUT_WU^```````````````````
I326_2_FC306FCAAXX:8:29:309:1409 chr1 597 - 0 0 99 99 99 0 01 0 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA HLHOBQCOOEGTP]LNJXVX`````J`````````

you can input these 2 files to make a mvf format file in mapview.

confirm that there is only one reference id , if there are multiple reference id ,please first use splitter to split the reference and alignment file

[Aengus]

Hi guys,

Just after a quick update.

Is the display of quality scores now in the download? The main page still says that the version is 1.0


Regards
Aengus

[guohui]

To Aengus,

Next version of MapView is in debugging period and will be available soon. The new version will support the display of quality score and pair-end data.

[lh3]

This sounds very promising! I just wonder if you are interested in natively supporting the SAM/BAM format. I think the 1000genomes project has already released some alignments in the BAM format and yet more to come in the next few months. I know it is trivial to convert SAM/BAM to MVF, but given the large amount of data (maybe >1TB data), most users would prefer viewing the alignment directly rather than duplicate them again. BAM is also compressed and indexable, and supports indels and long alignments. Sorry if this sounds like promoting projects related to myself.

[WJW-Davy]

MapView 3.0 beta1 is being tested...

MapView 3.0 beta2 is being tested.
MapView 3.0 has improved much. Quality Score, Paired-end data, structure variation, coverage distribution, quality distribution, text quick view, zoom in/out, and other features are supported.

[WJW-Davy]

Welcome to test MapView 3.1.0.0

MapView is quick and using small memory. Good performance.

MapView is based on .NET Framework. You can try it on Windows (with .NET 2.0 or higher) and Linux (with Mono 2.0 or higher).

Welcome to test MapView 3.1.0.0

Download: http://evolution.sysu.edu.cn/mapview/