Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • zlu
    Member
    • Nov 2008
    • 34

    #16
    I was trying to use your MapView to look at some ELAND alignment results but didn't get very far. Since I'm new to all next generation sequencing, please excuse my ignorant questions:

    1. Which ELAND alignment file should I use in the MVFmaker? I tried both the s_*_*export.txt and s_*_*_sorted.txt together with my reference genome. All I got were red x and no short reads.

    2. My Solexa data comes from a paired-end sequencing of a bacterial strain. How can I input the second read?

    Thank you.

    Comment

    • bioinfosm
      Senior Member
      • Jan 2008
      • 483

      #17
      I doubt if mapviewer works for paired end data!
      --
      bioinfosm

      Comment

      • griffon42
        Member
        • Jan 2009
        • 23

        #18
        Mapview overflow error

        @baohua100

        Thanks for all of your work on MapView...it's been very helpful so far and for the most part, working well.

        I am having one problem that's given me some trouble. I'm using MapView to look at MAQ data aligned to the mouse genome (mm9). Using MVF splitter, I look at each chromosome individually. This works fine up to a certain base number, but once I jump to (or scroll past) around position 10000000, MapView crashes and I get an OVERFLOW ERROR.

        I've tried running MapView on a number of different hardware platforms, and always encounter the same problem at the same positions.

        Any advice anyone can offer would be much appreciated.

        Thanks.

        Comment

        • WJW-Davy
          Member
          • Feb 2009
          • 23

          #19
          Thanks for your valuable suggestions. A new version is available. Download site: https://sites.google.com/site/wjwdavy/

          Recently we are busy programming and testing. MapView is updating. Detailed manual is available later. If you have any question or suggestion, please do not hesitate to contact us.

          (See MapView Home or MapView Lab)

          Download Link 1: https://sites.google.com/site/wjwdav...attredirects=0





          [Change Log - main versions]
          3.4.0 [2009.6.1]
          Run on Linux (e.g. Ubuntu 9) successfully.
          Some bugs were fixed.

          3.3.0 [2009.5.10]
          The feature 'Overview Bar' map was added.
          Double-click one line of SNP list to jump to its position not its SNP No.

          3.2.0 [2009.5.7]
          The bug about dealing with ambiguous nucleotides was fixed. (Note: In order to deal with ambiguous nucleotides correctly, new MVF file should be made. )
          sta2txt feature was added.

          3.1.4 [2009.5.2]
          Text could be copyed from SNP list.
          MVR file could be converted to text file. The SNP list could be exported to a flat file.

          3.0 [2009.3.8]
          Significant improvement.
          Quality Score, Paired-end data, structure variation, coverage distribution, quality distribution, text quick view, zoom in/out, and other features were supported.

          2.0 [2008.12.16]
          Significant improvement.
          Support many formats. Fasta format and text-based alignment results file(output by Eland, Maq, SOAP, MapNext, SeqMap … …).

          1.0 [2008.11.28]
          This was the first attempt.
          Only support MapNext's format
          Last edited by WJW-Davy; 06-01-2009, 06:15 PM.
          WJW-Davy
          HomePage: http://hi.baidu.com/wjwdavy
          Download Center: https://sites.google.com/site/wjwdavy/

          Comment

          • baohua100
            Senior Member
            • Jun 2008
            • 103

            #20
            Now we add ZOOM IN/OUT feature to MapView



            In next week mapview can display quality score.

            Comment

            • seq_GA
              Senior Member
              • Feb 2009
              • 124

              #21
              Hi P
              I am interested to use the tool.
              Please let me know whether to use eland_multi or eland_export or eland_sorted file to use as the input file?
              My second question is whether I can view only solexa single run and not the pair end reads?
              Thanks.

              Comment

              • baohua100
                Senior Member
                • Jun 2008
                • 103

                #22
                Originally posted by seq_GA View Post
                Hi P
                I am interested to use the tool.
                Please let me know whether to use eland_multi or eland_export or eland_sorted file to use as the input file?
                My second question is whether I can view only solexa single run and not the pair end reads?
                Thanks.
                input file:
                1. Reference sequence file (contains single sequence) and
                2. Eland formated alignment results file like this:
                I326_2_FC306FCAAXX:8:1:211:212 GATTTATCATGTAAGAGGTTGTCATTCAGAATGGT U0 1 0 0 4 chr1 R
                I326_2_FC306FCAAXX:8:1:913:158 GAAAAAGGAACCTCTGCAGACATATCATGCAACTG U0 1 0 0 164 chr1 R
                I326_2_FC306FCAAXX:8:1:183:435 GGGAGATTCCCATATCTTTTCCACTTTCCTCTTCC U0 1 0 0 530 chr1 F

                you can covert these 2 files to a MVF file in MapView, then open the MVF file to view results.


                If the reference file or alignment results file contains multiple reference sequence id, then you can click Splitter to split the file into multiple files and one file only contains only one reference id.

                Comment

                • bioinfosm
                  Senior Member
                  • Jan 2008
                  • 483

                  #23
                  Originally posted by baohua100 View Post
                  Now we add ZOOM IN/OUT feature to MapView



                  In next week mapview can display quality score.
                  Thats great! I can see this tool becoming really useful
                  Some very basic things that would be wonderful are things like

                  - the display as SNP position centered (currently the SNP is at immediate left)
                  - Auto put the reads in a window to the top of the screen. Its not intuitive to see a blank screen and then scroll down to see reads there
                  - thresholds for reads in both directions
                  - zooming out further than 4, to view the bigger landscape, shaded reverse mapped reads and red-font SNPs; and then click to center at any chosen position

                  Good luck..
                  --
                  bioinfosm

                  Comment

                  • baohua100
                    Senior Member
                    • Jun 2008
                    • 103

                    #24
                    The great majority of alignment viewer were designed for loading and processing big assembly file in the ACE format. This memory based design requires huge amount of memory not typically available to desktop computer users.

                    MapView converts the reference file and alignment result file to a single file in the MapView format (MVF). The MVF binary format, combined with effective compressing and indexing of the aligned reads, will enable reduction in disk usage and quick positioning.

                    MapView is a disk based viewer and it only loads displayed section of the alignment result into memory. This leads to a small burden on memory resources while not compromising the speed.

                    Comment

                    • baohua100
                      Senior Member
                      • Jun 2008
                      • 103

                      #25
                      Originally posted by yasutake View Post
                      To baofua100,

                      This must be useful !

                      I tried to use Mapview but I couldn't understand how to use it.

                      I'll be happy if you make the tutorial or the manual.

                      Besides, let me ask some questions.

                      1. Can map files of MAQ be imported to Mapview directly ?
                      2. Should I prepare the ref. sequence as a fasta format ?

                      reference :
                      >chr1
                      gaagcgtagtctagtcagcgtagtcgtaactcat

                      MAQ format:
                      I326_2_FC306FCAAXX:8:18:1354:1553 chr1 597 - 0 0 99 99 99 0 01 0 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA GGBFPOLQOPLHYRDOCLYM`OO^VSP``YR`_]T
                      I326_2_FC306FCAAXX:8:22:173:821 chr1 597 - 0 0 99 99 99 0 0 10 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA NHELOUPVTZUT_WU^```````````````````
                      I326_2_FC306FCAAXX:8:29:309:1409 chr1 597 - 0 0 99 99 99 0 01 0 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA HLHOBQCOOEGTP]LNJXVX`````J`````````

                      you can input these 2 files to make a mvf format file in mapview.

                      confirm that there is only one reference id , if there are multiple reference id ,please first use splitter to split the reference and alignment file

                      Comment

                      • Aengus
                        Junior Member
                        • Sep 2008
                        • 6

                        #26
                        Hi guys,

                        Just after a quick update.

                        Is the display of quality scores now in the download? The main page still says that the version is 1.0


                        Regards
                        Aengus

                        Comment

                        • guohui
                          Junior Member
                          • Feb 2009
                          • 2

                          #27
                          To Aengus,

                          Next version of MapView is in debugging period and will be available soon. The new version will support the display of quality score and pair-end data.

                          Comment

                          • lh3
                            Senior Member
                            • Feb 2008
                            • 686

                            #28
                            This sounds very promising! I just wonder if you are interested in natively supporting the SAM/BAM format. I think the 1000genomes project has already released some alignments in the BAM format and yet more to come in the next few months. I know it is trivial to convert SAM/BAM to MVF, but given the large amount of data (maybe >1TB data), most users would prefer viewing the alignment directly rather than duplicate them again. BAM is also compressed and indexable, and supports indels and long alignments. Sorry if this sounds like promoting projects related to myself.

                            Comment

                            • WJW-Davy
                              Member
                              • Feb 2009
                              • 23

                              #29
                              MapView 3.0 beta1 is being tested...

                              MapView 3.0 beta2 is being tested.
                              MapView 3.0 has improved much. Quality Score, Paired-end data, structure variation, coverage distribution, quality distribution, text quick view, zoom in/out, and other features are supported.
                              Last edited by WJW-Davy; 05-05-2009, 04:37 AM. Reason: add jpg
                              WJW-Davy
                              HomePage: http://hi.baidu.com/wjwdavy
                              Download Center: https://sites.google.com/site/wjwdavy/

                              Comment

                              • WJW-Davy
                                Member
                                • Feb 2009
                                • 23

                                #30
                                Welcome to test MapView 3.1.0.0

                                MapView is quick and using small memory. Good performance.

                                MapView is based on .NET Framework. You can try it on Windows (with .NET 2.0 or higher) and Linux (with Mono 2.0 or higher).

                                Welcome to test MapView 3.1.0.0


                                Download: http://evolution.sysu.edu.cn/mapview/
                                Last edited by WJW-Davy; 04-07-2009, 06:30 AM.
                                WJW-Davy
                                HomePage: http://hi.baidu.com/wjwdavy
                                Download Center: https://sites.google.com/site/wjwdavy/

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 07:41 AM
                                0 responses
                                9 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                22 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                36 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...