[baohua100]

To baofua100,

This must be useful !

I tried to use Mapview but I couldn't understand how to use it.

I'll be happy if you make the tutorial or the manual.

Besides, let me ask some questions.

1. Can map files of MAQ be imported to Mapview directly ?
2. Should I prepare the ref. sequence as a fasta format ?

reference :
>chr1
gaagcgtagtctagtcagcgtagtcgtaactcat

MAQ format:
I326_2_FC306FCAAXX:8:18:1354:1553 chr1 597 - 0 0 99 99 99 0 01 0 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA GGBFPOLQOPLHYRDOCLYM`OO^VSP``YR`_]T
I326_2_FC306FCAAXX:8:22:173:821 chr1 597 - 0 0 99 99 99 0 0 10 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA NHELOUPVTZUT_WU^```````````````````
I326_2_FC306FCAAXX:8:29:309:1409 chr1 597 - 0 0 99 99 99 0 01 0 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA HLHOBQCOOEGTP]LNJXVX`````J`````````

you can input these 2 files to make a mvf format file in mapview.

confirm that there is only one reference id , if there are multiple reference id ,please first use splitter to split the reference and alignment file

[baohua100]

The great majority of alignment viewer were designed for loading and processing big assembly file in the ACE format. This memory based design requires huge amount of memory not typically available to desktop computer users.

MapView converts the reference file and alignment result file to a single file in the MapView format (MVF). The MVF binary format, combined with effective compressing and indexing of the aligned reads, will enable reduction in disk usage and quick positioning.

MapView is a disk based viewer and it only loads displayed section of the alignment result into memory. This leads to a small burden on memory resources while not compromising the speed.

[bioinfosm]

Now we add ZOOM IN/OUT feature to MapView

http://evolution.sysu.edu.cn/software/mapview.htm

In next week mapview can display quality score.

Thats great! I can see this tool becoming really useful
Some very basic things that would be wonderful are things like

- the display as SNP position centered (currently the SNP is at immediate left)
- Auto put the reads in a window to the top of the screen. Its not intuitive to see a blank screen and then scroll down to see reads there
- thresholds for reads in both directions
- zooming out further than 4, to view the bigger landscape, shaded reverse mapped reads and red-font SNPs; and then click to center at any chosen position

Good luck..

[baohua100]

Hi P
I am interested to use the tool.
Please let me know whether to use eland_multi or eland_export or eland_sorted file to use as the input file?
My second question is whether I can view only solexa single run and not the pair end reads?
Thanks.

input file:
1. Reference sequence file (contains single sequence) and
2. Eland formated alignment results file like this:
I326_2_FC306FCAAXX:8:1:211:212 GATTTATCATGTAAGAGGTTGTCATTCAGAATGGT U0 1 0 0 4 chr1 R
I326_2_FC306FCAAXX:8:1:913:158 GAAAAAGGAACCTCTGCAGACATATCATGCAACTG U0 1 0 0 164 chr1 R
I326_2_FC306FCAAXX:8:1:183:435 GGGAGATTCCCATATCTTTTCCACTTTCCTCTTCC U0 1 0 0 530 chr1 F

you can covert these 2 files to a MVF file in MapView, then open the MVF file to view results.


If the reference file or alignment results file contains multiple reference sequence id, then you can click Splitter to split the file into multiple files and one file only contains only one reference id.

[seq_GA]

Hi P
I am interested to use the tool.
Please let me know whether to use eland_multi or eland_export or eland_sorted file to use as the input file?
My second question is whether I can view only solexa single run and not the pair end reads?
Thanks.

[baohua100]

Now we add ZOOM IN/OUT feature to MapView

http://evolution.sysu.edu.cn/software/mapview.htm

In next week mapview can display quality score.

[WJW-Davy]

Thanks for your valuable suggestions. A new version is available. Download site: https://sites.google.com/site/wjwdavy/

Recently we are busy programming and testing. MapView is updating. Detailed manual is available later. If you have any question or suggestion, please do not hesitate to contact us.

(See MapView Home or MapView Lab)

Download Link 1: https://sites.google.com/site/wjwdav...attredirects=0





[Change Log - main versions]
3.4.0 [2009.6.1]
Run on Linux (e.g. Ubuntu 9) successfully.
Some bugs were fixed.

3.3.0 [2009.5.10]
The feature 'Overview Bar' map was added.
Double-click one line of SNP list to jump to its position not its SNP No.

3.2.0 [2009.5.7]
The bug about dealing with ambiguous nucleotides was fixed. (Note: In order to deal with ambiguous nucleotides correctly, new MVF file should be made. )
sta2txt feature was added.

3.1.4 [2009.5.2]
Text could be copyed from SNP list.
MVR file could be converted to text file. The SNP list could be exported to a flat file.

3.0 [2009.3.8]
Significant improvement.
Quality Score, Paired-end data, structure variation, coverage distribution, quality distribution, text quick view, zoom in/out, and other features were supported.

2.0 [2008.12.16]
Significant improvement.
Support many formats. Fasta format and text-based alignment results file(output by Eland, Maq, SOAP, MapNext, SeqMap … …).

1.0 [2008.11.28]
This was the first attempt.
Only support MapNext's format

[griffon42]

Mapview overflow error

@baohua100

Thanks for all of your work on MapView...it's been very helpful so far and for the most part, working well.

I am having one problem that's given me some trouble. I'm using MapView to look at MAQ data aligned to the mouse genome (mm9). Using MVF splitter, I look at each chromosome individually. This works fine up to a certain base number, but once I jump to (or scroll past) around position 10000000, MapView crashes and I get an OVERFLOW ERROR.

I've tried running MapView on a number of different hardware platforms, and always encounter the same problem at the same positions.

Any advice anyone can offer would be much appreciated.

Thanks.

[bioinfosm]

I doubt if mapviewer works for paired end data!

[zlu]

I was trying to use your MapView to look at some ELAND alignment results but didn't get very far. Since I'm new to all next generation sequencing, please excuse my ignorant questions:

1. Which ELAND alignment file should I use in the MVFmaker? I tried both the s_*_*export.txt and s_*_*_sorted.txt together with my reference genome. All I got were red x and no short reads.

2. My Solexa data comes from a paired-end sequencing of a bacterial strain. How can I input the second read?

Thank you.

[unionicola]

MapView looks great, but I'm having trouble loading data into it. I used MVFMaker tool and loaded in the reference genome I used to align my data to and the .map file that I obtained from MAQ output (using the easyrun command).

However, when I load the MVF file into MapView, an error message appears: "No Reads in MVF!". Is there a specific setting I should have in the "Single Line Format" of the MVFMaker tool? I have been using the format with "maq" in the form since I used MAQ to build the .map file.

Any help anyone can provide would be very appreciated.

Thanks!

[Vince_Funari]

Paired end data

I am also interested, this looks very useful as many people have had issues lately with recent build from maqview for maq. And this looks like very user friendly tool, although displaying paired end data is critical for these short reads as it really helps the confidence levels of the data alignments.

My question is Does this support Paired end alignments generated by MAQ yet?

thank you
vince

Is it still useful for human data? Loading the entire human refseq, or you suggest that I rather upload just a single chromosome and view it..

I have mate-pair data that I wish to visualize; any changes when using mate-pair reads? Can I upload the 2 reads files?

Thanks

[bioinfosm]

Feature request - Zoom-out

There is no zoom feature on mapview tool? (apart from quality information as in previous post)

[Aengus]

Sorry - I hit send too soon.

From my maq mapview data mapview is not showing the quality scores associated with each base. This is quite important to see, especially when evaluating SNPs.

[Aengus]

Just to clarify regarding maq format files.

You need to run "maq mapview" and then use the resultant mapview files along with the reference sequence in fasta format to build the mapview MVF format file in the MVFMaker. The rest of the interaction is pretty intuitive. Arrow keys move around and the "Fast Positioning" box lets you enter a base position to jump to.

I have had to have a look at mapview as I have a scientist who uses only a PC and I couldnt get maqview-0.2.4 to build under cygwin on the PC.

If there was a cross-platform viewer as Heng Li has said that would be great, and would go some way to alleviating my issues with supporting scientists and their data analysis.