amos bank-transact show err

[bah]

Anyone tell me why ?

running:

bank-transact -c -b S1-S2.bnk -m S1-S2.afg

log file show:

AFG ..ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:1, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:2, message ignored
ERROR: Sequence and quality lengths disagree
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:4, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:5, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:6, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:7, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:8, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:9, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:10, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:11, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:12, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:13, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:14, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:15, message ignored
.
.
.
.
.
.

[bah]

afg file :

{RED
iid:8680569
eid:ChrX_ctg150561
seq:
CTAGCCTCTGTACCTTTGCAGTAATTTAAAGTGTTAGCCAATGTGAGCATTCTAAGTATG
TAATTCTCTTTCTGTGTCATTTGGACTATTCCAATACTCGGTGTGTCAGTAAACGTTGTA
AAATTGTCTT
.
qlt:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
.
frg:24678678
clr:0,130
}

[aloliveira]

Did you changed the iid?? Perhaps that is the error when you're running the bank-transact. The programm not founded the iid to execute the parsing. Change the iid by 1, 2, 3, and so on. A little script in PERL can handle with this. But what is the size of the afg file?? The assembly file was generated by what assembler??


Best regards,
André

[bah]

yes, you are right. Each read name in the fasta file have two whitespace which lead to err. I had renamed them , then reproduced AFG file and the err was disappear.
Thanks
Hengxing

[aloliveira]

We're welcome