Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • -daf-
    Junior Member
    • Feb 2009
    • 6

    Question about pthred quality

    Hi,
    i have a question about phred quality values in fastq format(Sanger).
    I know that phred quality = character_code - 33 and that error probability is 10^(-phred quality/10).
    So for " character(code=34), that is always appears in front of N character in sequence, quality is ~0.8 that is closest code for 0.75 error probability (all bases are equaly probable).
    But what about ! character (code=33)? error probability = 1
    Is it means that corresponding base in sequence wrong with probability=1 (at least >0.8) and other 3 bases equaly probable?
    For example:
    @SRR00XXXX
    TAAGTTTTCTTATTTATATAACTACATATTTTTTTA
    +SRR00XXXX
    I%0IIIII,I"$EI(%$$@?2!&(02*/&",&/-'%

    C in 22 position has quality ! (i.e in this position can be A or T or G but not C ?)
    Last edited by -daf-; 02-05-2009, 03:50 AM. Reason: misprint

Latest Articles

Collapse

  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.


    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM
  • SEQadmin2
    From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
    by SEQadmin2


    Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


    The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
    ...
    06-02-2026, 10:05 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 06-17-2026, 06:09 AM
0 responses
24 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-09-2026, 11:58 AM
0 responses
42 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-05-2026, 10:09 AM
0 responses
48 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-04-2026, 08:59 AM
0 responses
49 views
0 reactions
Last Post SEQadmin2  
Working...