Hi,
i have a question about phred quality values in fastq format(Sanger).
I know that phred quality = character_code - 33 and that error probability is 10^(-phred quality/10).
So for " character(code=34), that is always appears in front of N character in sequence, quality is ~0.8 that is closest code for 0.75 error probability (all bases are equaly probable).
But what about ! character (code=33)? error probability = 1
Is it means that corresponding base in sequence wrong with probability=1 (at least >0.8) and other 3 bases equaly probable?
For example:
@SRR00XXXX
TAAGTTTTCTTATTTATATAACTACATATTTTTTTA
+SRR00XXXX
I%0IIIII,I"$EI(%$$@?2!&(02*/&",&/-'%
C in 22 position has quality ! (i.e in this position can be A or T or G but not C ?)
-
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...07-31-2026, 11:01 AM