Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • kentnf
    Member
    • Jan 2009
    • 26

    #1

    How to using euler-sr to assebling 454 seq?

    I install eular in ubuntu8.10 x64, it runs well assembling sample data.
    command is : ${EUSRC}/assembly/Assemble.pl reads.fa 25

    Then i use my 454 seqs, it has been clean ahead.
    command is: ${EUSRC}/assembly/Assemble.pl 454reads.fa 25

    But the result looks have some mistakes. two assemblied seqs like that:
    >RUX0000005
    TGAATGTGTTCATGATGGTTGGGGGGTTGCTGTACTTGTTGGAGTG
    >RUX0000006
    TGAATGTGTTCATGATGGTTGGGGGTTGCTGTACTTGTTGGAGTG

    I think they are the same, but they are not assembly to one seq using euler-sr.

    Who can tell me what the problem I have?

    Thank you very much.

    PS: I also want to know how to check the quality of the contig file like cap3 or phrap results.
  • mchaisso
    Member
    • Apr 2008
    • 84

    #2
    Most sequences like this get merged, so I'm not sure what happened in this case.

    You can manually re-do some of the steps in the assembly to get rid of these with the following commands:

    mkdir simple2
    ${EUSRC}/assembly/${MACHTYPE}/simplifyGraph simple/454reads.fa simple2/454reads.fa -removeBulges 75 -removeWhirls 75
    ${EUSRC}/assembly/${MACHTYPE}/transformGraph simple2/454reads.fa transformed/454reads.fa -minPathCount 3 -notStrict
    ${EUSRC}/assembly/${MACHTYPE}/printContigs transformed/454reads.fa
    cp transformed/reads.fa.contig .

    I've added a few changes in the forthcoming release that improve assembly results on unpaired 454 reads (or general improvements in the step that resolves repeats without mate pairs). If you want to post these reads I'll try and make sure this assembly is fixed in the release.

    -mark

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 08-06-2026, 07:41 AM
    0 responses
    23 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-03-2026, 10:13 AM
    0 responses
    37 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-31-2026, 02:55 AM
    0 responses
    43 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    26 views
    0 reactions
    Last Post SEQadmin2  
    Working...