Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • How to using euler-sr to assebling 454 seq?

    I install eular in ubuntu8.10 x64, it runs well assembling sample data.
    command is : ${EUSRC}/assembly/Assemble.pl reads.fa 25

    Then i use my 454 seqs, it has been clean ahead.
    command is: ${EUSRC}/assembly/Assemble.pl 454reads.fa 25

    But the result looks have some mistakes. two assemblied seqs like that:
    >RUX0000005
    TGAATGTGTTCATGATGGTTGGGGGGTTGCTGTACTTGTTGGAGTG
    >RUX0000006
    TGAATGTGTTCATGATGGTTGGGGGTTGCTGTACTTGTTGGAGTG

    I think they are the same, but they are not assembly to one seq using euler-sr.

    Who can tell me what the problem I have?

    Thank you very much.

    PS: I also want to know how to check the quality of the contig file like cap3 or phrap results.

  • #2
    Most sequences like this get merged, so I'm not sure what happened in this case.

    You can manually re-do some of the steps in the assembly to get rid of these with the following commands:

    mkdir simple2
    ${EUSRC}/assembly/${MACHTYPE}/simplifyGraph simple/454reads.fa simple2/454reads.fa -removeBulges 75 -removeWhirls 75
    ${EUSRC}/assembly/${MACHTYPE}/transformGraph simple2/454reads.fa transformed/454reads.fa -minPathCount 3 -notStrict
    ${EUSRC}/assembly/${MACHTYPE}/printContigs transformed/454reads.fa
    cp transformed/reads.fa.contig .

    I've added a few changes in the forthcoming release that improve assembly results on unpaired 454 reads (or general improvements in the step that resolves repeats without mate pairs). If you want to post these reads I'll try and make sure this assembly is fixed in the release.

    -mark

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM
    • seqadmin
      Strategies for Sequencing Challenging Samples
      by seqadmin


      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
      03-22-2024, 06:39 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    32 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    37 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 09:21 AM
    0 responses
    31 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-04-2024, 09:00 AM
    0 responses
    53 views
    0 likes
    Last Post seqadmin  
    Working...
    X