Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • kentnf
    Member
    • Jan 2009
    • 26

    How to using euler-sr to assebling 454 seq?

    I install eular in ubuntu8.10 x64, it runs well assembling sample data.
    command is : ${EUSRC}/assembly/Assemble.pl reads.fa 25

    Then i use my 454 seqs, it has been clean ahead.
    command is: ${EUSRC}/assembly/Assemble.pl 454reads.fa 25

    But the result looks have some mistakes. two assemblied seqs like that:
    >RUX0000005
    TGAATGTGTTCATGATGGTTGGGGGGTTGCTGTACTTGTTGGAGTG
    >RUX0000006
    TGAATGTGTTCATGATGGTTGGGGGTTGCTGTACTTGTTGGAGTG

    I think they are the same, but they are not assembly to one seq using euler-sr.

    Who can tell me what the problem I have?

    Thank you very much.

    PS: I also want to know how to check the quality of the contig file like cap3 or phrap results.
  • mchaisso
    Member
    • Apr 2008
    • 84

    #2
    Most sequences like this get merged, so I'm not sure what happened in this case.

    You can manually re-do some of the steps in the assembly to get rid of these with the following commands:

    mkdir simple2
    ${EUSRC}/assembly/${MACHTYPE}/simplifyGraph simple/454reads.fa simple2/454reads.fa -removeBulges 75 -removeWhirls 75
    ${EUSRC}/assembly/${MACHTYPE}/transformGraph simple2/454reads.fa transformed/454reads.fa -minPathCount 3 -notStrict
    ${EUSRC}/assembly/${MACHTYPE}/printContigs transformed/454reads.fa
    cp transformed/reads.fa.contig .

    I've added a few changes in the forthcoming release that improve assembly results on unpaired 454 reads (or general improvements in the step that resolves repeats without mate pairs). If you want to post these reads I'll try and make sure this assembly is fixed in the release.

    -mark

    Comment

    Latest Articles

    Collapse

    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      Yesterday, 11:43 AM
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 06-30-2026, 05:37 AM
    0 responses
    11 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-26-2026, 11:10 AM
    0 responses
    18 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-17-2026, 06:09 AM
    0 responses
    52 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-09-2026, 11:58 AM
    0 responses
    111 views
    0 reactions
    Last Post SEQadmin2  
    Working...