Hi all,
I have upload a txt format NGS data, after that ,under "Change Datatype" set "New Type" to interval and then click "Execute". The dataset I created like this:
chr10 91346072 91346098 - 2119.5.1 0 ATACTAGAAAACTCTAATGTCCAAAA
chr15 9879235 9879261 - 2119.5.2 0 AGACAAAACTCACATTCTTTCTATCA
chr5 45627890 45627916 + 2119.5.3 1 GGGCGGCCCTGGGGATGCTCCCTCCA
chr18 24025706 24025732 - 2119.5.4 0 CTGGTATATATTAAAAGCCACTCCTC
This history column did not show "display at UCSC main "
How can I get visialized in UCSC genome browser?
I have upload a txt format NGS data, after that ,under "Change Datatype" set "New Type" to interval and then click "Execute". The dataset I created like this:
chr10 91346072 91346098 - 2119.5.1 0 ATACTAGAAAACTCTAATGTCCAAAA
chr15 9879235 9879261 - 2119.5.2 0 AGACAAAACTCACATTCTTTCTATCA
chr5 45627890 45627916 + 2119.5.3 1 GGGCGGCCCTGGGGATGCTCCCTCCA
chr18 24025706 24025732 - 2119.5.4 0 CTGGTATATATTAAAAGCCACTCCTC
This history column did not show "display at UCSC main "
How can I get visialized in UCSC genome browser?
Comment