Header Leaderboard Ad

Collapse

1000 genome SNP call

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • heekim1
    replied
    mpileup generates only chr1 in a bcf file

    Originally posted by colindaven View Post
    I think you're right, the error is in the name of the reference sequence. Check to see the chromosome names in the alignment and reference are _exactly_ the same. We have had this problem frequently.
    Hi,
    I had a similar situation.
    I have a bam file containing read maps across entire chromosomes.
    I did mpileup,

    samtools mpileup -uf Homo_sapiens_assembly18.fasta s_4.merged.sorted.rmdup.bam | bcftools view -cvbg - > s_4.merged.sorted.rmdup.bam.raw.bcf

    by using bcftools view s_4.merged.sorted.rmdup.bam.raw.bcf > s_4.merged.sorted.rmdup.bam.raw.vcf,

    I realized that the .vcf file has SNP information on only chr1.
    there is no chr2, chr3, ... or chrX

    Do you have any idea about this problem?

    As you suggested, i checked the chromosome name in both reference sequence and bam file. the name is identical.

    Here is a part of my .fai derived from the reference sequence:
    chrM 16571 6 50 51
    chr1 247249719 16915 50 51
    chr2 242951149 252211635 50 51
    chr3 199501827 500021813 50 51
    chr4 191273063 703513683 50 51
    chr5 180857866 898612214 50 51
    :
    :

    Here is a part of my .bam file:
    HWI-EAS276_0022_FC70B81AAXX:4:91:4774:3269#0/1 0 chr1 12060 255 34M * 0 0 CTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATG BB=B=DD;[email protected] XA:i:0 MD:Z:34 NM:i:0

    :
    :
    HWI-EAS276_0022_FC70B81AAXX:4:29:16345:8488#0/1 16 chr2 34145 255 34M * 0 0 TCATAGTTCTGCTAGACTTCTCTGAGGTGAGCTA @IGDIGIHDIIIIHIIIIGIIIIIIIIHGIIIII XA:i:0 MD:Z:34 NM:i:0
    HW
    :
    :
    HWI-EAS276_0022_FC70B81AAXX:4:63:1614:2851#0/1 0 chr3 90279 255 34M * 0 0 TTTTATAAGGGGCTTTTCCCCCTTTGCTCAGCAC IIIIHIDIIIHHIIIIIIIIIIDIIIIHBHHHGH XA:i:0 MD:Z:34 NM:i:0


    Thank you

    Hee

    Leave a comment:


  • colindaven
    replied
    I think you're right, the error is in the name of the reference sequence. Check to see the chromosome names in the alignment and reference are _exactly_ the same. We have had this problem frequently.

    Leave a comment:


  • zhanglu295
    replied
    Thank you very much for your help.

    Because I just want to call SNP for each individual separately, so the command used is:

    samtools pileup -vcf ref.fa aln.bam > raw.pileup

    I think it should be the issue of reference sequence, which I used for snp call is UCSC hg19. Maybe I can test whether this problem still exist after changing the reference sequence.

    Leave a comment:


  • ulz_peter
    replied
    Just a quick guess:
    Samtools homepage recommends snp calling with the following command:

    1. samtools mpileup -uf ref.fa aln1.bam aln2.bam | bcftools view -bvcg - > var.raw.bcf
    2. bcftools view var.raw.bcf | vcfutils.pl varFilter -D100 > var.flt.vcf

    One possible cause for your problem could lie in the reference sequence. 1000genomes use reference sequences called 1,2,3,4,5,6,etc for the chromosomes
    If you use chr1,chr2,chr3 (UCSC-style) reference sequence, that could possibly lead to an empty pileup file.

    Leave a comment:


  • ulz_peter
    replied
    Could you give the exact command of you SNP calling step?

    Leave a comment:


  • zhanglu295
    started a topic 1000 genome SNP call

    1000 genome SNP call

    I want to call SNPs from the 1000 genome project original .bam files

    Such as the data we can download from:

    ftp://ftp.1000genomes.ebi.ac.uk/vol1...096/alignment/

    I used samtools to call SNPs from the bam file named "HG00096.mapped.ILLUMINA.bwa.GBR.low_coverage.20101123.bam" in this folder.

    but the pileup file is empty, the snp call procedure should be correct, is the bam file incompleted or other potential problems?

    Please give me some advise.

    Thank you very much

    Eric
Working...
X