Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • zhanglu295
    Junior Member
    • Mar 2011
    • 8

    1000 genome SNP call

    I want to call SNPs from the 1000 genome project original .bam files

    Such as the data we can download from:

    ftp://ftp.1000genomes.ebi.ac.uk/vol1...096/alignment/

    I used samtools to call SNPs from the bam file named "HG00096.mapped.ILLUMINA.bwa.GBR.low_coverage.20101123.bam" in this folder.

    but the pileup file is empty, the snp call procedure should be correct, is the bam file incompleted or other potential problems?

    Please give me some advise.

    Thank you very much

    Eric
  • ulz_peter
    Senior Member
    • Feb 2010
    • 219

    #2
    Could you give the exact command of you SNP calling step?

    Comment

    • ulz_peter
      Senior Member
      • Feb 2010
      • 219

      #3
      Just a quick guess:
      Samtools homepage recommends snp calling with the following command:

      1. samtools mpileup -uf ref.fa aln1.bam aln2.bam | bcftools view -bvcg - > var.raw.bcf
      2. bcftools view var.raw.bcf | vcfutils.pl varFilter -D100 > var.flt.vcf

      One possible cause for your problem could lie in the reference sequence. 1000genomes use reference sequences called 1,2,3,4,5,6,etc for the chromosomes
      If you use chr1,chr2,chr3 (UCSC-style) reference sequence, that could possibly lead to an empty pileup file.

      Comment

      • zhanglu295
        Junior Member
        • Mar 2011
        • 8

        #4
        Thank you very much for your help.

        Because I just want to call SNP for each individual separately, so the command used is:

        samtools pileup -vcf ref.fa aln.bam > raw.pileup

        I think it should be the issue of reference sequence, which I used for snp call is UCSC hg19. Maybe I can test whether this problem still exist after changing the reference sequence.

        Comment

        • colindaven
          Senior Member
          • Oct 2008
          • 417

          #5
          I think you're right, the error is in the name of the reference sequence. Check to see the chromosome names in the alignment and reference are _exactly_ the same. We have had this problem frequently.

          Comment

          • heekim1
            Junior Member
            • Dec 2010
            • 1

            #6
            mpileup generates only chr1 in a bcf file

            Originally posted by colindaven View Post
            I think you're right, the error is in the name of the reference sequence. Check to see the chromosome names in the alignment and reference are _exactly_ the same. We have had this problem frequently.
            Hi,
            I had a similar situation.
            I have a bam file containing read maps across entire chromosomes.
            I did mpileup,

            samtools mpileup -uf Homo_sapiens_assembly18.fasta s_4.merged.sorted.rmdup.bam | bcftools view -cvbg - > s_4.merged.sorted.rmdup.bam.raw.bcf

            by using bcftools view s_4.merged.sorted.rmdup.bam.raw.bcf > s_4.merged.sorted.rmdup.bam.raw.vcf,

            I realized that the .vcf file has SNP information on only chr1.
            there is no chr2, chr3, ... or chrX

            Do you have any idea about this problem?

            As you suggested, i checked the chromosome name in both reference sequence and bam file. the name is identical.

            Here is a part of my .fai derived from the reference sequence:
            chrM 16571 6 50 51
            chr1 247249719 16915 50 51
            chr2 242951149 252211635 50 51
            chr3 199501827 500021813 50 51
            chr4 191273063 703513683 50 51
            chr5 180857866 898612214 50 51
            :
            :

            Here is a part of my .bam file:
            HWI-EAS276_0022_FC70B81AAXX:4:91:4774:3269#0/1 0 chr1 12060 255 34M * 0 0 CTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATG BB=B=DD;DBBBBBDEEDD?ABABEDFEFGGG@G XA:i:0 MD:Z:34 NM:i:0

            :
            :
            HWI-EAS276_0022_FC70B81AAXX:4:29:16345:8488#0/1 16 chr2 34145 255 34M * 0 0 TCATAGTTCTGCTAGACTTCTCTGAGGTGAGCTA @IGDIGIHDIIIIHIIIIGIIIIIIIIHGIIIII XA:i:0 MD:Z:34 NM:i:0
            HW
            :
            :
            HWI-EAS276_0022_FC70B81AAXX:4:63:1614:2851#0/1 0 chr3 90279 255 34M * 0 0 TTTTATAAGGGGCTTTTCCCCCTTTGCTCAGCAC IIIIHIDIIIHHIIIIIIIIIIDIIIIHBHHHGH XA:i:0 MD:Z:34 NM:i:0


            Thank you

            Hee

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              Yesterday, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              07-08-2026, 05:17 AM
            • GATTACAT
              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by GATTACAT
              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
              07-01-2026, 11:43 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Yesterday, 10:04 AM
            0 responses
            10 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-08-2026, 10:08 AM
            0 responses
            9 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-07-2026, 11:05 AM
            0 responses
            16 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-02-2026, 11:08 AM
            0 responses
            31 views
            0 reactions
            Last Post SEQadmin2  
            Working...