Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • 1000 genome SNP call

    I want to call SNPs from the 1000 genome project original .bam files

    Such as the data we can download from:

    I used samtools to call SNPs from the bam file named "HG00096.mapped.ILLUMINA.bwa.GBR.low_coverage.20101123.bam" in this folder.

    but the pileup file is empty, the snp call procedure should be correct, is the bam file incompleted or other potential problems?

    Please give me some advise.

    Thank you very much


  • #2
    Could you give the exact command of you SNP calling step?


    • #3
      Just a quick guess:
      Samtools homepage recommends snp calling with the following command:

      1. samtools mpileup -uf ref.fa aln1.bam aln2.bam | bcftools view -bvcg - > var.raw.bcf
      2. bcftools view var.raw.bcf | varFilter -D100 > var.flt.vcf

      One possible cause for your problem could lie in the reference sequence. 1000genomes use reference sequences called 1,2,3,4,5,6,etc for the chromosomes
      If you use chr1,chr2,chr3 (UCSC-style) reference sequence, that could possibly lead to an empty pileup file.


      • #4
        Thank you very much for your help.

        Because I just want to call SNP for each individual separately, so the command used is:

        samtools pileup -vcf ref.fa aln.bam > raw.pileup

        I think it should be the issue of reference sequence, which I used for snp call is UCSC hg19. Maybe I can test whether this problem still exist after changing the reference sequence.


        • #5
          I think you're right, the error is in the name of the reference sequence. Check to see the chromosome names in the alignment and reference are _exactly_ the same. We have had this problem frequently.


          • #6
            mpileup generates only chr1 in a bcf file

            Originally posted by colindaven View Post
            I think you're right, the error is in the name of the reference sequence. Check to see the chromosome names in the alignment and reference are _exactly_ the same. We have had this problem frequently.
            I had a similar situation.
            I have a bam file containing read maps across entire chromosomes.
            I did mpileup,

            samtools mpileup -uf Homo_sapiens_assembly18.fasta s_4.merged.sorted.rmdup.bam | bcftools view -cvbg - > s_4.merged.sorted.rmdup.bam.raw.bcf

            by using bcftools view s_4.merged.sorted.rmdup.bam.raw.bcf > s_4.merged.sorted.rmdup.bam.raw.vcf,

            I realized that the .vcf file has SNP information on only chr1.
            there is no chr2, chr3, ... or chrX

            Do you have any idea about this problem?

            As you suggested, i checked the chromosome name in both reference sequence and bam file. the name is identical.

            Here is a part of my .fai derived from the reference sequence:
            chrM 16571 6 50 51
            chr1 247249719 16915 50 51
            chr2 242951149 252211635 50 51
            chr3 199501827 500021813 50 51
            chr4 191273063 703513683 50 51
            chr5 180857866 898612214 50 51

            Here is a part of my .bam file:
            HWI-EAS276_0022_FC70B81AAXX:4:91:4774:3269#0/1 0 chr1 12060 255 34M * 0 0 CTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATG BB=B=DD;DBBBBBDEEDD?ABABEDFEFGGG@G XA:i:0 MD:Z:34 NM:i:0

            HWI-EAS276_0022_FC70B81AAXX:4:29:16345:8488#0/1 16 chr2 34145 255 34M * 0 0 TCATAGTTCTGCTAGACTTCTCTGAGGTGAGCTA @IGDIGIHDIIIIHIIIIGIIIIIIIIHGIIIII XA:i:0 MD:Z:34 NM:i:0

            Thank you



            Latest Articles


            • seqadmin
              Essential Discoveries and Tools in Epitranscriptomics
              by seqadmin

              The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
              04-22-2024, 07:01 AM
            • seqadmin
              Current Approaches to Protein Sequencing
              by seqadmin

              Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
              04-04-2024, 04:25 PM





            Topics Statistics Last Post
            Started by seqadmin, Yesterday, 08:47 AM
            0 responses
            Last Post seqadmin  
            Started by seqadmin, 04-11-2024, 12:08 PM
            0 responses
            Last Post seqadmin  
            Started by seqadmin, 04-10-2024, 10:19 PM
            0 responses
            Last Post seqadmin  
            Started by seqadmin, 04-10-2024, 09:21 AM
            0 responses
            Last Post seqadmin  