Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • JoaoMoura
    Junior Member
    • Mar 2011
    • 2

    RNASeq - overrepresent sequences

    Hey guys!

    First of all, I'm sorry If I'm puting this question in the wrong section, but I'm new to this forum.

    Well, I'm doing DE with RNASeq and after doing some QA and QC (removed the solexa adapter and trimmed the reads) I still have an 2 overrepresented sequences from most of my fasta files, which are:

    CGATGAAGAACGCAGCGAAATG

    CCCCCTGGAATACCAAGGGGCG

    Do you have any idea what they are?

    Thanks a lot!
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    Were any PCR primers used in preparing the sample?

    Comment

    • JoaoMoura
      Junior Member
      • Mar 2011
      • 2

      #3
      Hi!

      Actually I'm not sure. But background is not biological, but I tried looking in the article and suplementary material, but I didn't find anything.

      This is the article:

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-24-2026, 12:17 PM
      0 responses
      25 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-23-2026, 11:41 AM
      0 responses
      19 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      26 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      38 views
      0 reactions
      Last Post SEQadmin2  
      Working...