Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • mforthman
    Junior Member
    • Sep 2021
    • 1

    bbmap inflating read count and not finding one sequence after header

    I'm using bbmap to map transcriptome reads to a set of target loci. I'm working with 12 samples with pair-end reads and 1 sample with single-end reads, all from NCBI's SRA. I'm having no problems with bbmap reading paired-end data and completing analyses correctly. It's the one sample with single-end reads that's causing two issues:

    1. The first issue is that the input fasta file only has 288915 reads. I have confirmed this with grep ">" file.fasta | wc -l. However, bbmap reports "Reads used: 308655". I have no idea why the read count is inflated; again, this is not an issue with the paired-end data.

    2. bbmap fails to recognize a sequence immediately after the fasta header: "Warning: A fasta header with no sequence was encountered: SRR768524.9631" The sequence in question is formatted exactly like all others in the file and I have checked the EOL, which is fine. Below is what a snippet of the fasta file looks like, with the 3rd sequence being the problematic one for bbmap.

    >SRR768524.9629
    CTATCAAAGGGAAATCCCGCTGGCCTGCTATCATACAGTCTTGAACCTCCACATGCAATATCAGCTGAATCTCCAACGTGGCCGCTGACAAATGGAGTAACTACGACTGCCAAAACGAAAGCGCGACCTCCTTTCCATCCCATGGGTAATTGGAGTCTTTGAGGAAATCCACATCGGCCAGCCTCTGAATAATGGAATGGTTCCTTCTGGTTGAGTGCACTGTTTATTGAAGTGTAAAGAGACCTGAATCCTTCTTGGTCATGGATAAAGAGGGGAGAATCTGTTGAACTTCTTTCCCACACATTAACACCCTCAGTCAATTTTACTGGGAAACGGTCAATTTCAAATAAGCTAGTTTTGCTTGGTCATAAGTGAGGAAATGTTCATCAGAATCATATTTCGGTCCAATGAATACTCTCACAATGGCATCATCAGCTTTT
    >SRR768524.9630
    ATAATGCAATTATAGATTGTTGGAGTGCAGGTAAAGCTACCACTGTTATGATTAAAGATAATCCAAAGGTTGAAATTCTTGATGTAGAAGATGTTAAGGTTGGAAAGATAAGACAATTTTGTGAGTTGGACTTGGCATTGAACATGGCCTTACGAAAGTATTTTGGTAGTGTGTTTGATAAAATGGCAGTTACATCTAATGAAACGCCGTGGAAAGTTGCTTGGAATCCATATTTTATGCCTCATCACATCGTGGCGATAGAGAACGACAAGTACGATGTCTTTTGTATAGATGTGAAAAGAATGGATAAGAATTTACCAGTCCAATTCACTGAGATATTGTGT
    >SRR768524.9631
    TGTTACTGGGTAGGGCTGTGGCACTGGGACCTTGACTGGATAGGGTACATGCTTCTCGACTGGTACTGGGTATGGCTTGGGAATGTGGACAGGGTATGGCCTATCGACTGGGACCTTCACGGGATAGGGAACTTTCTTCTCGATATGGACTGGATAAGGTACTGGTACCTCCTTGTGGATGGTGATAGCTTTAATGTGGCCGTGTTCCTCATGTCCTCCGAGTTCATAGCCACCTCCATATCCGTATCCTCCTAAGTCATGTCCACCTCCATATCCTCCATGTCCACCGCCGTATCCTCCAAGCTCATAACCACCTCCATATCCTAAGCCAAGAAGTCCTCGTTTCTCCTGCTTCTTGTCATCTGTTGGTGCCGCTGCTTTGTCGGTCTTGGATTCGGCCTTCTTCTCTTCAGCTGATGCTGTGGCAAGCAGTGCCAACAGCCCTACCCACAGTACCTTGGATTGCATTGTTGAGTCGTGGTGTGGTCGGCGTCTCCCAA
    >SRR768524.9632
    AATTCCCAACGACCAAGTATCTGAACATGAGTGGATCAATGCTGAGATCCTGCCTGCTACTGCTATTCCTAGCTTACTGTGTGTCCTGCTATAGAAGTCATGTTCCTAGAGGCGGGAGTTACTCTCTACCGCCTGGAGTTAATCCAACATTCCCAGGAAGGAACCAAGGACTGCCTCCGGCTTATCATGGAAAATTCAAGAGATCACTGGAAGGAGGTTTAGAACCTGAAGATGGTGGTGTCCTTGCAGTTGATGAACCTGCTGATTATCTGAAAGTCAAAAGGTCAGTGGAAGATGTTGAAGGTGAATTCCTTGTGAACGAAGAACCTCAAGAATTTGAGACACTGAGAGCGCGCCGTGACGTCAGAATAATTCATCCAACT
    >SRR768524.9633
    TTCCAAACTGTCGATTCATGATGTACACAATACCAAAAAAGGCAAATAAGAAATAAAAGT
    I'm at a loss for figuring out how to resolve these issues. I appreciate any help in getting this to run properly on this last fasta file.
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Is there a specific reason you converted these reads to fasta format? If this is data from SRA then you should be able to map the fastq reads directly.

    You may be getting secondary alignments and that may be the reason why your read count seems inflated.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM
    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-13-2026, 10:26 AM
    0 responses
    28 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    37 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-08-2026, 10:08 AM
    0 responses
    25 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-07-2026, 11:05 AM
    0 responses
    35 views
    0 reactions
    Last Post SEQadmin2  
    Working...