Is there a specific reason you converted these reads to fasta format? If this is data from SRA then you should be able to map the fastq reads directly.
You may be getting secondary alignments and that may be the reason why your read count seems inflated.
-
bbmap inflating read count and not finding one sequence after header
I'm using bbmap to map transcriptome reads to a set of target loci. I'm working with 12 samples with pair-end reads and 1 sample with single-end reads, all from NCBI's SRA. I'm having no problems with bbmap reading paired-end data and completing analyses correctly. It's the one sample with single-end reads that's causing two issues:
1. The first issue is that the input fasta file only has 288915 reads. I have confirmed this with grep ">" file.fasta | wc -l. However, bbmap reports "Reads used: 308655". I have no idea why the read count is inflated; again, this is not an issue with the paired-end data.
2. bbmap fails to recognize a sequence immediately after the fasta header: "Warning: A fasta header with no sequence was encountered: SRR768524.9631" The sequence in question is formatted exactly like all others in the file and I have checked the EOL, which is fine. Below is what a snippet of the fasta file looks like, with the 3rd sequence being the problematic one for bbmap.
I'm at a loss for figuring out how to resolve these issues. I appreciate any help in getting this to run properly on this last fasta file.>SRR768524.9629
CTATCAAAGGGAAATCCCGCTGGCCTGCTATCATACAGTCTTGAACCTCCACATGCAATATCAGCTGAATCTCCAACGTGGCCGCTGACAAATGGAGTAACTACGACTGCCAAAACGAAAGCGCGACCTCCTTTCCATCCCATGGGTAATTGGAGTCTTTGAGGAAATCCACATCGGCCAGCCTCTGAATAATGGAATGGTTCCTTCTGGTTGAGTGCACTGTTTATTGAAGTGTAAAGAGACCTGAATCCTTCTTGGTCATGGATAAAGAGGGGAGAATCTGTTGAACTTCTTTCCCACACATTAACACCCTCAGTCAATTTTACTGGGAAACGGTCAATTTCAAATAAGCTAGTTTTGCTTGGTCATAAGTGAGGAAATGTTCATCAGAATCATATTTCGGTCCAATGAATACTCTCACAATGGCATCATCAGCTTTT
>SRR768524.9630
ATAATGCAATTATAGATTGTTGGAGTGCAGGTAAAGCTACCACTGTTATGATTAAAGATAATCCAAAGGTTGAAATTCTTGATGTAGAAGATGTTAAGGTTGGAAAGATAAGACAATTTTGTGAGTTGGACTTGGCATTGAACATGGCCTTACGAAAGTATTTTGGTAGTGTGTTTGATAAAATGGCAGTTACATCTAATGAAACGCCGTGGAAAGTTGCTTGGAATCCATATTTTATGCCTCATCACATCGTGGCGATAGAGAACGACAAGTACGATGTCTTTTGTATAGATGTGAAAAGAATGGATAAGAATTTACCAGTCCAATTCACTGAGATATTGTGT
>SRR768524.9631
TGTTACTGGGTAGGGCTGTGGCACTGGGACCTTGACTGGATAGGGTACATGCTTCTCGACTGGTACTGGGTATGGCTTGGGAATGTGGACAGGGTATGGCCTATCGACTGGGACCTTCACGGGATAGGGAACTTTCTTCTCGATATGGACTGGATAAGGTACTGGTACCTCCTTGTGGATGGTGATAGCTTTAATGTGGCCGTGTTCCTCATGTCCTCCGAGTTCATAGCCACCTCCATATCCGTATCCTCCTAAGTCATGTCCACCTCCATATCCTCCATGTCCACCGCCGTATCCTCCAAGCTCATAACCACCTCCATATCCTAAGCCAAGAAGTCCTCGTTTCTCCTGCTTCTTGTCATCTGTTGGTGCCGCTGCTTTGTCGGTCTTGGATTCGGCCTTCTTCTCTTCAGCTGATGCTGTGGCAAGCAGTGCCAACAGCCCTACCCACAGTACCTTGGATTGCATTGTTGAGTCGTGGTGTGGTCGGCGTCTCCCAA
>SRR768524.9632
AATTCCCAACGACCAAGTATCTGAACATGAGTGGATCAATGCTGAGATCCTGCCTGCTACTGCTATTCCTAGCTTACTGTGTGTCCTGCTATAGAAGTCATGTTCCTAGAGGCGGGAGTTACTCTCTACCGCCTGGAGTTAATCCAACATTCCCAGGAAGGAACCAAGGACTGCCTCCGGCTTATCATGGAAAATTCAAGAGATCACTGGAAGGAGGTTTAGAACCTGAAGATGGTGGTGTCCTTGCAGTTGATGAACCTGCTGATTATCTGAAAGTCAAAAGGTCAGTGGAAGATGTTGAAGGTGAATTCCTTGTGAACGAAGAACCTCAAGAATTTGAGACACTGAGAGCGCGCCGTGACGTCAGAATAATTCATCCAACT
>SRR768524.9633
TTCCAAACTGTCGATTCATGATGTACACAATACCAAAAAAGGCAAATAAGAAATAAAAGT
-
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...07-20-2026, 11:48 AM -
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...07-09-2026, 11:10 AM -
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...07-08-2026, 05:17 AM
Leave a comment: