Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Ancestro
    Member
    • Oct 2015
    • 15

    Btw, I had a weird issue in trimmomatic last day, it confuses files from the options or the trimming commands, i checked for additional spaces or strange characters, but nothing. Later I retyped the command as the first time and worked again. Do someone had a same problem?

    Comment

    • mgbfx9
      Member
      • Sep 2015
      • 25

      Thank you GenoMax, mastal, Ancestro for your suggestions. I was not well, so couldn’t do further and I'm sorry for my delayed response of your help.

      I took all of your suggestions, and if I understood correctly, I modified the code the following way, and ran from the directory where the Trimmomatic is located, but I think the program couldn’t find the trimmer.

      [mydir Trimmomatic-0.33]$ java -jar trimmomatic-0.33.jar PE -threads 8 -phred33 –trimlog logfile_sample1 /home/mydir/ngs_trimm/sample1_L001_R1_001.fastq /home/mydir /ngs_trimm/sample1_L001_R2_001.fastq /home/mydir/ngs_trimm/output_forwardP.fastq
      /home/ mydir/ngs_trimm/output_forwardU.fastq /home/mydir/ngs_trimm/output_reverseP.fastq
      /home/ mydir/ngs_trimm/output_reverseU.fastq ILLUMINACLIP:/home/mydir/Trimmomatic-0.33/adapters/NexteraPE-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

      Output:
      TrimmomaticPE: Started with arguments: -threads 8 -phred33 –trimlog /home/mydir/ngs_trimm/logfile_sample1 ……. Started with my full code and
      Exception in thread "main" java.lang.RuntimeException: Unknown trimmer: /home/mydir/ngs_trimm/output_reverseP.fastq
      at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:60)
      at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:496)
      at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:35)

      What did I do wrong? Any help is appreciated!
      Thank you in advance,

      Comment

      • kmcarr
        Senior Member
        • May 2008
        • 1181

        Originally posted by mgbfx9 View Post
        Thank you GenoMax, mastal, Ancestro for your suggestions. I was not well, so couldn’t do further and I'm sorry for my delayed response of your help.

        I took all of your suggestions, and if I understood correctly, I modified the code the following way, and ran from the directory where the Trimmomatic is located, but I think the program couldn’t find the trimmer.

        Code:
        [mydir Trimmomatic-0.33]$ java -jar trimmomatic-0.33.jar PE -threads 8 -phred33 –trimlog logfile_sample1 /home/mydir/ngs_trimm/sample1_L001_R1_001.fastq /home/[COLOR="Red"]mydir /ngs_trimm[/COLOR]/sample1_L001_R2_001.fastq /home/mydir/ngs_trimm/output_forwardP.fastq /home[COLOR="Red"]/ mydir/[/COLOR]ngs_trimm/output_forwardU.fastq /home/mydir/ngs_trimm/output_reverseP.fastq /home[COLOR="red"]/ mydir/[/COLOR]ngs_trimm/output_reverseU.fastq ILLUMINACLIP:/home/mydir/Trimmomatic-0.33/adapters/NexteraPE-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36     
        
        Output:
        TrimmomaticPE: Started with arguments: -threads 8 -phred33 –trimlog /home/mydir/ngs_trimm/logfile_sample1 ……. Started with my full code and
        Exception in thread "main" java.lang.RuntimeException: Unknown trimmer: /home/mydir/ngs_trimm/output_reverseP.fastq
                at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:60)
                at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:496)
                at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:35)
        What did I do wrong? Any help is appreciated!
        Thank you in advance,
        What went wrong is you appear to have a number of spaces (three in total) in your command line that shouldn't be there. See the portions of your command line above which I have highlighted in red (BTW it makes command line and code segments much easier to read on this forum if you use the 'CODE' tags to surround them when creating post.)

        Trimmomatic, like many *NIX commands interprets groups separated by spaces on a command line to be separate arguments. With the improper spaces in your command here is how Trimmomatic is interpreting what you typed:

        Code:
        Input file #1:           /home/mydir/ngs_trimm/sample1_L001_R1_001.fastq
        Input file #2:           /home/mydir
        Output file #1 paired:   /ngs_trimm/sample1_L001_R2_001.fastq
        Output file #1 unpaired: /home/mydir/ngs_trimm/output_forwardP.fastq
        Output file #2 paired:   /home/
        Output file #2 unpaired: mydir/ngs_trimm/output_forwardU.fastq
        First trimmer to apply:  /home/mydir/ngs_trimm/output_reverseP.fastq
        etc., etc.
        Trimmomatic is telling you in the error message that it doesn't recognize the trimmer "/home/mydir/ngs_trimm/output_reverseP.fastq" (obviously). Remove the improper spaces from your command line and try again.

        Comment

        • mastal
          Senior Member
          • Mar 2009
          • 666

          Have you checked to make sure the error isn't caused by having spaces in the wrong places (in the middle of the path to a file), or missing spaces in places where there should be spaces?

          In the code that you have posted above, for example, there are spaces between 'home' and the rest of your path in at least a couple of places.

          Comment

          • mgbfx9
            Member
            • Sep 2015
            • 25

            Hi kmcarr and mastal,

            Thank you for your suggestion.

            No, I didn't have any spaces in between the original code. Here when I posted my code, I took out the name of my directory for privacy, so here I missed the spaces when I was typing. Although I checked again my code and ran, but got the same message. However, I am not sure whether I have missing spaces in places where they should not be. I can give you the code again.

            Thanks in advance for your suggestion,

            Comment

            • kmcarr
              Senior Member
              • May 2008
              • 1181

              Originally posted by mgbfx9 View Post
              Hi kmcarr and mastal,

              Thank you for your suggestion.

              No, I didn't have any spaces in between the original code. Here when I posted my code, I took out the name of my directory for privacy, so here I missed the spaces when I was typing. Although I checked again my code and ran, but got the same message. However, I am not sure whether I have missing spaces in places where they should not be. I can give you the code again.

              Thanks in advance for your suggestion,
              Code:
              Exception in thread "main" java.lang.RuntimeException: [COLOR="Red"]Unknown trimmer: /home/mydir/ngs_trimm/output_reverseP.fastq[/COLOR]
              Trimmomatic clearly states what error it encountered. The only reasonable explantation for this error is that you have inadvertently passed extra arguments to Trimmomatic on your command line, and the presence of spaces in you pathnames as I outlined above would lead to the creation of these extra arguments and Trimmomatic throwing exactly the error it has.

              Comment

              • mgbfx9
                Member
                • Sep 2015
                • 25

                Hi kmcarr,
                Thank you for your response. Let me check again my codes, and will let you know the update.

                Comment

                • mgbfx9
                  Member
                  • Sep 2015
                  • 25

                  Finally, I got the problem solved. That is not due to the space in the code, but a small thing, -trimlog was –trimlog! I can not believe that minor thing can make so much problem.

                  Thank you everyone for all the help.

                  Comment

                  • mgbfx9
                    Member
                    • Sep 2015
                    • 25

                    Hi,

                    I got another problem, I need your help.

                    I used Trimmomatic-0.33 to preprocess my MiSeq data which removed my adapter sequences and the low-quality reads and generated fastq files.
                    Now I took this processed fastq files to do de novo assembly with Soapdenovo2, the assembler could not open my file. It has the same header as the original. Output says that "Import reads from file...... Cannot open. Now exiting the system".

                    I used Soapdenovo2 for de novo assembly of these MiSeq data before preprocessing, they could read my file, but as the contig values were pretty low, I preprocessed my data, but now the assembler could not open the preprocessed files.

                    What could be wrong?
                    Any help would be appreciated, thanks!

                    Comment

                    • GenoMax
                      Senior Member
                      • Feb 2008
                      • 7142

                      At a minimum did you make sure that full file paths are included to wherever these trimmed files are when you ran SoapdeNovo2? The error message seems to indicate that these files can't be opened/read. Also did you make sure that these files actually have something in them i.e. they are not empty (I know it sounds stupid but this is a problem new people sometimes have with unix files).

                      Comment

                      • mgbfx9
                        Member
                        • Sep 2015
                        • 25

                        Thank you, GenoMax for your suggestion.

                        Yes, I am sure the full paths are included. I have ran Soapdenovo2 earlier with these files but they were not trimmed. So I have the configuration file, I did exactly what I did before.
                        And also I checked whether these files have anything because I had the same doubt, and they are not empty, may be they are little shorter in sizes but they have same headers.
                        I am wondering whether they could be corrupted? Would it be possible during the trimming?
                        Thanks,

                        Comment

                        • GenoMax
                          Senior Member
                          • Feb 2008
                          • 7142

                          They shouldn't have become corrupted during trimming. Did you check the trimlog file after the run? Were there any errors/problems noted in that file? Did the stats look reasonable (small number of reads trimmed)?

                          Comment

                          • mgbfx9
                            Member
                            • Sep 2015
                            • 25

                            Hi GenoMax,

                            Yes, I also don’t think there would be any corruption during trimming. I just checked again the trimlog file as you suggested, I don’t see any errors/problems in the file. Although I am not expert in reading the trimlog file, but what I understood from the trimlog file description from Trimmomatic:

                            -trimlog
                            Specifying a trimlog file creates a log of all read trimmings,
                            indicating the following details:
                            • the read name
                            • the surviving sequence length
                            • the location of the first surviving base, aka. the amount
                            trimmed from the start
                            • the location of the last surviving base in the original read
                            • the amount trimmed from the end
                            Multiple steps can be specified as required, by using additional
                            arguments at the end.
                            Most steps take one or more settings, delimited by ´:´ (a colon)

                            I wish I knew which one is which more better.

                            Here is one of my file with header and first few lines before trimming:

                            @HWI-M01825:177:000000000-AGYW0:1:1101:15470:1332 1:N:0:NAAGGCG
                            AAATAAAACCGGGCACAACACGAAGGCGCATTTCCGATATCCATAAAGAGTCGGTCTTGTCTGTTACTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACAGAAAAAAAAAAACAGAGAAGAGAATACAGGCTAAGAGAATATTATTAGAGAATTGACAATATGAGATAAGTAAAGAAATAGAAGTCATATGATAGCACAGATA
                            +
                            CDDDDFFFFCCCGGGGGGGGGGGGGGHGGGGGHHHGGGGGHHHHHHHHHHHHGGFGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGHGGGGGGHHHHHHGGGF/GHHGGHHHHGDGHGHHHHHHGGHHHHGGCGGG###########################################################################################################

                            Here is the same file with header and first few lines after trimming:

                            @HWI-M01825:177:000000000-AGYW0:1:1101:15276:1342 1:N:0:TAAGGCG
                            GCATAAACGCTGGTCATGAAATGACGAAGGCTATCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACCCGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCAGGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGGAAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATTAATCATATGCGTGATG
                            +
                            BABBBFFFBBB??GGGGGGGGGHH42FEFGEHHHHGFGGGHHHHBGHFEDHFHHFFDHHHHHGGGGGGGHGFGGGHHFFEGGFEEG?EEE?EEHBHFFHEGFHFHHHHHGG@D?HHHFHBGCG/CDHFHHHFHHFFGHHHHHHHGFHFHGG?-EGGHHHA@DGGGGBFB@@@BGFGGBFFFFBBFFBFBE/BBBFB;?BEBFFF/F?BEEFA.E;.FFFFFFFFFFFFFF?BFFEFFFFFFFBFAADFF

                            Here is the same file with its trimlog with first few lines:

                            HWI-M01825:177:000000000-AGYW0:1:1101:15470:1332 1:N:0:NAAGGCG 66 0 66 184
                            HWI-M01825:177:000000000-AGYW0:1:1101:15470:1332 2:N:0:NAAGGCG 0 0 0 0
                            HWI-M01825:177:000000000-AGYW0:1:1101:15423:1336 1:N:0:NAAGGCG 212 0 212 38
                            HWI-M01825:177:000000000-AGYW0:1:1101:15423:1336 2:N:0:NAAGGCG 0 0 0 0
                            HWI-M01825:177:000000000-AGYW0:1:1101:15276:1342 1:N:0:TAAGGCG 249 0 249 1

                            Any idea?
                            Thanks in advance,

                            Comment

                            • mgbfx9
                              Member
                              • Sep 2015
                              • 25

                              Another thing, I thought to mention that after using Trimmomatic tools, the end of the output reported:

                              Input Read Pairs: 3032230 Both Surviving: 1084634 (35.77%) Forward Only Surviving: 1933475 (63.76%) Reverse Only Surviving: 606 (0.02%) Dropped: 13515 (0.45%)
                              TrimmomaticPE: Completed successfully.

                              Comment

                              • GenoMax
                                Senior Member
                                • Feb 2008
                                • 7142

                                Hmm. That is a significant fraction of reads where only one read from the pair is surviving.

                                Have you ever posted what the FastQC reports looked like for this run? When you were doing it wrong (post # 162) 99% of reads were surviving so it looks like either your reads have a lot of adapter contamination or you may be doing something incorrect. How long were the reads to begin with (you have asked for minlength 36)?

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                23 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                215 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                79 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...