Btw, I had a weird issue in trimmomatic last day, it confuses files from the options or the trimming commands, i checked for additional spaces or strange characters, but nothing. Later I retyped the command as the first time and worked again. Do someone had a same problem?
Unconfigured Ad
Collapse
X
-
Thank you GenoMax, mastal, Ancestro for your suggestions. I was not well, so couldn’t do further and I'm sorry for my delayed response of your help.
I took all of your suggestions, and if I understood correctly, I modified the code the following way, and ran from the directory where the Trimmomatic is located, but I think the program couldn’t find the trimmer.
[mydir Trimmomatic-0.33]$ java -jar trimmomatic-0.33.jar PE -threads 8 -phred33 –trimlog logfile_sample1 /home/mydir/ngs_trimm/sample1_L001_R1_001.fastq /home/mydir /ngs_trimm/sample1_L001_R2_001.fastq /home/mydir/ngs_trimm/output_forwardP.fastq
/home/ mydir/ngs_trimm/output_forwardU.fastq /home/mydir/ngs_trimm/output_reverseP.fastq
/home/ mydir/ngs_trimm/output_reverseU.fastq ILLUMINACLIP:/home/mydir/Trimmomatic-0.33/adapters/NexteraPE-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Output:
TrimmomaticPE: Started with arguments: -threads 8 -phred33 –trimlog /home/mydir/ngs_trimm/logfile_sample1 ……. Started with my full code and
Exception in thread "main" java.lang.RuntimeException: Unknown trimmer: /home/mydir/ngs_trimm/output_reverseP.fastq
at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:60)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:496)
at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:35)
What did I do wrong? Any help is appreciated!
Thank you in advance,
Comment
-
-
What went wrong is you appear to have a number of spaces (three in total) in your command line that shouldn't be there. See the portions of your command line above which I have highlighted in red (BTW it makes command line and code segments much easier to read on this forum if you use the 'CODE' tags to surround them when creating post.)Originally posted by mgbfx9 View PostThank you GenoMax, mastal, Ancestro for your suggestions. I was not well, so couldn’t do further and I'm sorry for my delayed response of your help.
I took all of your suggestions, and if I understood correctly, I modified the code the following way, and ran from the directory where the Trimmomatic is located, but I think the program couldn’t find the trimmer.
What did I do wrong? Any help is appreciated!Code:[mydir Trimmomatic-0.33]$ java -jar trimmomatic-0.33.jar PE -threads 8 -phred33 –trimlog logfile_sample1 /home/mydir/ngs_trimm/sample1_L001_R1_001.fastq /home/[COLOR="Red"]mydir /ngs_trimm[/COLOR]/sample1_L001_R2_001.fastq /home/mydir/ngs_trimm/output_forwardP.fastq /home[COLOR="Red"]/ mydir/[/COLOR]ngs_trimm/output_forwardU.fastq /home/mydir/ngs_trimm/output_reverseP.fastq /home[COLOR="red"]/ mydir/[/COLOR]ngs_trimm/output_reverseU.fastq ILLUMINACLIP:/home/mydir/Trimmomatic-0.33/adapters/NexteraPE-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 Output: TrimmomaticPE: Started with arguments: -threads 8 -phred33 –trimlog /home/mydir/ngs_trimm/logfile_sample1 ……. Started with my full code and Exception in thread "main" java.lang.RuntimeException: Unknown trimmer: /home/mydir/ngs_trimm/output_reverseP.fastq at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:60) at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:496) at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:35)
Thank you in advance,
Trimmomatic, like many *NIX commands interprets groups separated by spaces on a command line to be separate arguments. With the improper spaces in your command here is how Trimmomatic is interpreting what you typed:
Trimmomatic is telling you in the error message that it doesn't recognize the trimmer "/home/mydir/ngs_trimm/output_reverseP.fastq" (obviously). Remove the improper spaces from your command line and try again.Code:Input file #1: /home/mydir/ngs_trimm/sample1_L001_R1_001.fastq Input file #2: /home/mydir Output file #1 paired: /ngs_trimm/sample1_L001_R2_001.fastq Output file #1 unpaired: /home/mydir/ngs_trimm/output_forwardP.fastq Output file #2 paired: /home/ Output file #2 unpaired: mydir/ngs_trimm/output_forwardU.fastq First trimmer to apply: /home/mydir/ngs_trimm/output_reverseP.fastq etc., etc.
Comment
-
-
Have you checked to make sure the error isn't caused by having spaces in the wrong places (in the middle of the path to a file), or missing spaces in places where there should be spaces?
In the code that you have posted above, for example, there are spaces between 'home' and the rest of your path in at least a couple of places.
Comment
-
-
Hi kmcarr and mastal,
Thank you for your suggestion.
No, I didn't have any spaces in between the original code. Here when I posted my code, I took out the name of my directory for privacy, so here I missed the spaces when I was typing. Although I checked again my code and ran, but got the same message. However, I am not sure whether I have missing spaces in places where they should not be. I can give you the code again.
Thanks in advance for your suggestion,
Comment
-
-
Originally posted by mgbfx9 View PostHi kmcarr and mastal,
Thank you for your suggestion.
No, I didn't have any spaces in between the original code. Here when I posted my code, I took out the name of my directory for privacy, so here I missed the spaces when I was typing. Although I checked again my code and ran, but got the same message. However, I am not sure whether I have missing spaces in places where they should not be. I can give you the code again.
Thanks in advance for your suggestion,Trimmomatic clearly states what error it encountered. The only reasonable explantation for this error is that you have inadvertently passed extra arguments to Trimmomatic on your command line, and the presence of spaces in you pathnames as I outlined above would lead to the creation of these extra arguments and Trimmomatic throwing exactly the error it has.Code:Exception in thread "main" java.lang.RuntimeException: [COLOR="Red"]Unknown trimmer: /home/mydir/ngs_trimm/output_reverseP.fastq[/COLOR]
Comment
-
-
Hi,
I got another problem, I need your help.
I used Trimmomatic-0.33 to preprocess my MiSeq data which removed my adapter sequences and the low-quality reads and generated fastq files.
Now I took this processed fastq files to do de novo assembly with Soapdenovo2, the assembler could not open my file. It has the same header as the original. Output says that "Import reads from file...... Cannot open. Now exiting the system".
I used Soapdenovo2 for de novo assembly of these MiSeq data before preprocessing, they could read my file, but as the contig values were pretty low, I preprocessed my data, but now the assembler could not open the preprocessed files.
What could be wrong?
Any help would be appreciated, thanks!
Comment
-
-
At a minimum did you make sure that full file paths are included to wherever these trimmed files are when you ran SoapdeNovo2? The error message seems to indicate that these files can't be opened/read. Also did you make sure that these files actually have something in them i.e. they are not empty (I know it sounds stupid but this is a problem new people sometimes have with unix files).
Comment
-
-
Thank you, GenoMax for your suggestion.
Yes, I am sure the full paths are included. I have ran Soapdenovo2 earlier with these files but they were not trimmed. So I have the configuration file, I did exactly what I did before.
And also I checked whether these files have anything because I had the same doubt, and they are not empty, may be they are little shorter in sizes but they have same headers.
I am wondering whether they could be corrupted? Would it be possible during the trimming?
Thanks,
Comment
-
-
Hi GenoMax,
Yes, I also don’t think there would be any corruption during trimming. I just checked again the trimlog file as you suggested, I don’t see any errors/problems in the file. Although I am not expert in reading the trimlog file, but what I understood from the trimlog file description from Trimmomatic:
-trimlog
Specifying a trimlog file creates a log of all read trimmings,
indicating the following details:
• the read name
• the surviving sequence length
• the location of the first surviving base, aka. the amount
trimmed from the start
• the location of the last surviving base in the original read
• the amount trimmed from the end
Multiple steps can be specified as required, by using additional
arguments at the end.
Most steps take one or more settings, delimited by ´:´ (a colon)
I wish I knew which one is which more better.
Here is one of my file with header and first few lines before trimming:
@HWI-M01825:177:000000000-AGYW0:1:1101:15470:1332 1:N:0:NAAGGCG
AAATAAAACCGGGCACAACACGAAGGCGCATTTCCGATATCCATAAAGAGTCGGTCTTGTCTGTTACTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACAGAAAAAAAAAAACAGAGAAGAGAATACAGGCTAAGAGAATATTATTAGAGAATTGACAATATGAGATAAGTAAAGAAATAGAAGTCATATGATAGCACAGATA
+
CDDDDFFFFCCCGGGGGGGGGGGGGGHGGGGGHHHGGGGGHHHHHHHHHHHHGGFGGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGHGGGGGGHHHHHHGGGF/GHHGGHHHHGDGHGHHHHHHGGHHHHGGCGGG###########################################################################################################
Here is the same file with header and first few lines after trimming:
@HWI-M01825:177:000000000-AGYW0:1:1101:15276:1342 1:N:0:TAAGGCG
GCATAAACGCTGGTCATGAAATGACGAAGGCTATCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACCCGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCAGGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGGAAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATTAATCATATGCGTGATG
+
BABBBFFFBBB??GGGGGGGGGHH42FEFGEHHHHGFGGGHHHHBGHFEDHFHHFFDHHHHHGGGGGGGHGFGGGHHFFEGGFEEG?EEE?EEHBHFFHEGFHFHHHHHGG@D?HHHFHBGCG/CDHFHHHFHHFFGHHHHHHHGFHFHGG?-EGGHHHA@DGGGGBFB@@@BGFGGBFFFFBBFFBFBE/BBBFB;?BEBFFF/F?BEEFA.E;.FFFFFFFFFFFFFF?BFFEFFFFFFFBFAADFF
Here is the same file with its trimlog with first few lines:
HWI-M01825:177:000000000-AGYW0:1:1101:15470:1332 1:N:0:NAAGGCG 66 0 66 184
HWI-M01825:177:000000000-AGYW0:1:1101:15470:1332 2:N:0:NAAGGCG 0 0 0 0
HWI-M01825:177:000000000-AGYW0:1:1101:15423:1336 1:N:0:NAAGGCG 212 0 212 38
HWI-M01825:177:000000000-AGYW0:1:1101:15423:1336 2:N:0:NAAGGCG 0 0 0 0
HWI-M01825:177:000000000-AGYW0:1:1101:15276:1342 1:N:0:TAAGGCG 249 0 249 1
Any idea?
Thanks in advance,
Comment
-
-
Another thing, I thought to mention that after using Trimmomatic tools, the end of the output reported:
Input Read Pairs: 3032230 Both Surviving: 1084634 (35.77%) Forward Only Surviving: 1933475 (63.76%) Reverse Only Surviving: 606 (0.02%) Dropped: 13515 (0.45%)
TrimmomaticPE: Completed successfully.
Comment
-
-
Hmm. That is a significant fraction of reads where only one read from the pair is surviving.
Have you ever posted what the FastQC reports looked like for this run? When you were doing it wrong (post # 162) 99% of reads were surviving so it looks like either your reads have a lot of adapter contamination or you may be doing something incorrect. How long were the reads to begin with (you have asked for minlength 36)?
Comment
-
Latest Articles
Collapse
-
by SEQadmin2
Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.
The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...-
Channel: Articles
06-02-2026, 10:05 AM -
-
by SEQadmin2
With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.
Introduction
Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...-
Channel: Articles
05-22-2026, 06:42 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Yesterday, 10:09 AM
|
0 responses
10 views
0 reactions
|
Last Post
by SEQadmin2
Yesterday, 10:09 AM
|
||
|
Started by SEQadmin2, 06-04-2026, 08:59 AM
|
0 responses
20 views
0 reactions
|
Last Post
by SEQadmin2
06-04-2026, 08:59 AM
|
||
|
Started by SEQadmin2, 06-02-2026, 12:03 PM
|
0 responses
27 views
0 reactions
|
Last Post
by SEQadmin2
06-02-2026, 12:03 PM
|
||
|
Started by SEQadmin2, 06-02-2026, 11:40 AM
|
0 responses
21 views
0 reactions
|
Last Post
by SEQadmin2
06-02-2026, 11:40 AM
|
Comment