Tweet
Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?
Code:
$ head -6 clc_trim_pair4.fq
-
-
This is what I get:Originally posted by GenoMax View Post
@No_name
CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@No_name
TTTTTTTTTTTTTTTTCTTTTCTCAACTTCCTTCACCTTCACACTCTCTTTCCCTTCTTCComment
-
Is that all the sequence in the file? Just one record?
If not, are all sequences called "NO_name"? That is not going to work since the names are not unique.
Post output of.
Code:$ ls -lh clc_trim_pair4.fq
Comment
-
Hi all,
I've been trying to download Bowtie2.2.5 for Mac and followed instructions on this forum. The consistent error message I've been getting is: (ERR): Expected bowtie2 to be in same directory with bowtie2-align: /Applications/bowtie2-2.2.5/
I've followed suggestions from others with this problem to address this and I've realized that bowtie2-align is not in the folder I am downloading. Is this normal? Do I need to retrieve it elsewhere? I assume I am missing something basic since I am new to all this. Thanks in advance for any help.Comment
-
bowtie2 web site appears to be experiencing issues at the moment (can't get to the 2.2.6 code). Are you downloading the pre-compiled binary zip file for OS X from this link: http://sourceforge.net/projects/bowt...owtie2/2.2.5/? After uncompressing the archive all files you need should be in the uncompressed folder.Comment
-
Thanks for the reply. Yes I've downloaded that file but it does not contain bowtie2-align.Comment
-
I just checked the zip archive and the executables are all there (there are multiple align versions, bowtie2-align-l,bowtie2-align-s etc). You should run bowtie2 like so
Code:$ bowtie2 -help
Comment
-
Got it, thank you!Comment
-
error message: bowtie2 installation on mac
Hello, I'm not familiar to informatics and I try to install Bowtie2 on mac. I download bowtie2 source file.zip
I unzip it then when I did 'make' I have this error message:
1 error generated.
In file included from aligner_swsse_ee_u8.cpp:56:
In file included from ./aligner_sw.h:73:
./sse_wrap.h:31:10: fatal error: 'simde/x86/sse2.h' file not found
#include "simde/x86/sse2.h"
Could you help me.
Thank youComment
-
Download pre-compiled binary for macOS from here.
Consider using "conda" to install these programs that will save you a lot of time/headache.Comment
-
The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...Today, 07:48 AM -
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...04-22-2024, 07:01 AM
Comment