Header Leaderboard Ad

Collapse

Feedback on new site layout

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • SandraIves
    replied
    I love the new theme.
    Last edited by SandraIves; 01-11-2023, 10:51 PM.

    Leave a comment:


  • karyakarte
    replied
    Hello Sequencers!

    Leave a comment:


  • vivianshaw
    replied
    It looks really better! Good work!

    Leave a comment:


  • Mighty8284
    replied
    Compute Count2(CATGCCATTCGCATTGTCCCAGTGA, CCC).

    Leave a comment:


  • scienceguy
    started a topic Feedback on new site layout

    Feedback on new site layout

    We've updated the look and feel of SEQanswers and would love feedback from you. Just reply here - we want to hear your opinions!
    Last edited by scienceguy; 05-26-2022, 03:03 PM.

Latest Articles

Collapse

  • seqadmin
    A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
    by seqadmin


    ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

    01-24-2023, 01:19 PM
  • seqadmin
    Introduction to Single-Cell Sequencing
    by seqadmin
    Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

    The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
    ...
    01-09-2023, 03:10 PM

ad_right_rmr

Collapse
Working...
X