Header Leaderboard Ad

Collapse

Feedback on new site layout

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Feedback on new site layout

    We've updated the look and feel of SEQanswers and would love feedback from you. Just reply here - we want to hear your opinions!
    Last edited by scienceguy; 05-26-2022, 03:03 PM.

  • #2
    Compute Count2(CATGCCATTCGCATTGTCCCAGTGA, CCC).

    Comment


    • #3
      It looks really better! Good work!

      Comment


      • #4
        Hello Sequencers!

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Improved Targeted Sequencing: A Comprehensive Guide to Amplicon Sequencing
          by seqadmin



          Amplicon sequencing is a targeted approach that allows researchers to investigate specific regions of the genome. This technique is routinely used in applications such as variant identification, clinical research, and infectious disease surveillance. The amplicon sequencing process begins by designing primers that flank the regions of interest. The DNA sequences are then amplified through PCR (typically multiplex PCR) to produce amplicons complementary to the targets. RNA targets...
          03-21-2023, 01:49 PM
        • seqadmin
          Targeted Sequencing: Choosing Between Hybridization Capture and Amplicon Sequencing
          by seqadmin




          Targeted sequencing is an effective way to sequence and analyze specific genomic regions of interest. This method enables researchers to focus their efforts on their desired targets, as opposed to other methods like whole genome sequencing that involve the sequencing of total DNA. Utilizing targeted sequencing is an attractive option for many researchers because it is often faster, more cost-effective, and only generates applicable data. While there are many approaches...
          03-10-2023, 05:31 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Yesterday, 11:44 AM
        0 responses
        8 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 03-24-2023, 02:45 PM
        0 responses
        18 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 03-22-2023, 12:26 PM
        0 responses
        18 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 03-17-2023, 12:32 PM
        0 responses
        19 views
        0 likes
        Last Post seqadmin  
        Working...
        X