htseq-count error with tophat input

[moser]

Hi all
When using htseq-count with sam-files from tophat and gff files from cufflinks, i got following error:

Error occured in line 1 of file /home/ubelix/sm/mm08c348/counts/ilc31se.sorted.sam.
Error: Strand must be'+', '-', or '.'.
[Exception type: ValueError, raised in _HTSeq.pyx:72]

cmd: htseq-count -t transcript -i ID -s no file.sam cufflinks.gff' > htseq-count

I checked for the strands in gff file, they look ok (either . - or +). sam file was sorted using sort -n on the bam precursor, so should be ok.
Any help on this issue would be appreciated!!
Thank you!
Michel

[Chinvt]

I'm currently having exactly same error for name-sorted SAM version of tophat generated BAM file.

How did you solve this problem then?

[alanlhutchison]

Hello,

I am having the same problem. Here is the error and the first line of the file in question (paths redacted):

Error occured in line 1 of file HC25_4-1_ZT02_1_combined_2.sam.
Error: Strand must be'+', '-', or '.'.
[Exception type: ValueError, raised in _HTSeq.pyx:71]

head -1 HC25_4-1_ZT02_1_combined_2.sam

HWI-ST1083:106:C1G1MACXX:2:1113:20418:56674:1:N:0:GTGAAA 272 chr2L 49M * 0 0 GACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCAT hhiihhfgcggfiiihiifhhiiiihihhiiiiiiigggggeeeeebb_ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:49 YT:Z:UU NH:i:20 CC:Z:= CP:i:4124 HI:i:0


Any advice on the matter would be appreciated.

[Simon Anders]

GFF files contain strand information as '+' and '-', SAM files don't. Maybe you have passed the two file names in the wrong order.

[dpryan]

Hello,

I am having the same problem. Here is the error and the first line of the file in question (paths redacted):

Error occured in line 1 of file HC25_4-1_ZT02_1_combined_2.sam.
Error: Strand must be'+', '-', or '.'.
[Exception type: ValueError, raised in _HTSeq.pyx:71]

head -1 HC25_4-1_ZT02_1_combined_2.sam

HWI-ST1083:106:C1G1MACXX:2:1113:20418:56674:1:N:0:GTGAAA 272 chr2L 49M * 0 0 GACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCAT hhiihhfgcggfiiihiifhhiiiihihhiiiiiiigggggeeeeebb_ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:49 YT:Z:UU NH:i:20 CC:Z:= CP:i:4124 HI:i:0


Any advice on the matter would be appreciated.

I suspect that you're putting the SAM file were the annotation file should go. The SAM file goes before the annotation file in the command.