Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • sunnyvu
    Member
    • Mar 2010
    • 17

    #1

    Hello from Sunny

    Hi everyone

    I am new to the forum. I have just started to analyze the RNAseq data. I am a little confused on the "accepted_hits.sam" from Tophat. How to interpret this file? What kinds of informaiton does this file contain? Thanks in advance.
  • ECO
    --Site Admin--
    • Oct 2007
    • 1360

    #2
    Welcome! I assume you've read the TopHat manual?

    Comment

    • sunnyvu
      Member
      • Mar 2010
      • 17

      #3
      Yes, I had read the manual previously. Today I spent all day to figure out the meaning for each column in "accepted_hits.sam" file. First I want to thank the members in this community. I read lots of posts and they are so useful and helpful. I still have two questions.

      1) based on the results in ""accepted_hits.sam", how to decide which is right-read and left-read.
      HWI-EAS266_0005:1:1:1295:1179#0 113 chr1 554327 255 43M = 40043719 0 GGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGC BBBBBBBBBBBBBBBBBB```````````````KKLHFEEFHO NM:i:0
      HWI-EAS266_0005:1:1:1561:15347#0 163 chr1 554418 255 43M = 554511 0 AATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATAA bbbbbbbbbbbbabbbbbbbbbbbabbbbabbabbbbbbbb`_ NM:i:1
      HWI-EAS266_0005:1:1:1330:2415#0 163 chr1 554438 255 43M = 554556 0 CAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACC bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb\ba^ NM:i:2
      2) We conducted the pair-end sequencing, I provided both end sequences in the command (/tophat -r 70 -o <..> hg18 s1_1_sequence.txt s_1_2_sequence.txt). Why is the ISIZE 0 not the second position subtract the first position?
      Thanks,

      Comment

      • nilshomer
        Nils Homer
        • Nov 2008
        • 1283

        #4
        Originally posted by sunnyvu View Post
        Yes, I had read the manual previously. Today I spent all day to figure out the meaning for each column in "accepted_hits.sam" file. First I want to thank the members in this community. I read lots of posts and they are so useful and helpful. I still have two questions.

        1) based on the results in ""accepted_hits.sam", how to decide which is right-read and left-read.
        HWI-EAS266_0005:1:1:1295:1179#0 113 chr1 554327 255 43M = 40043719 0 GGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGC BBBBBBBBBBBBBBBBBB```````````````KKLHFEEFHO NM:i:0
        HWI-EAS266_0005:1:1:1561:15347#0 163 chr1 554418 255 43M = 554511 0 AATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATAA bbbbbbbbbbbbabbbbbbbbbbbabbbbabbabbbbbbbb`_ NM:i:1
        HWI-EAS266_0005:1:1:1330:2415#0 163 chr1 554438 255 43M = 554556 0 CAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACC bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb\ba^ NM:i:2
        2) We conducted the pair-end sequencing, I provided both end sequences in the command (/tophat -r 70 -o <..> hg18 s1_1_sequence.txt s_1_2_sequence.txt). Why is the ISIZE 0 not the second position subtract the first position?
        Thanks,
        1) See the SAM Manual, specifically the FLAG field (2nd column). You can use "samtools view -X <sam/bam>" to print the FLAG field into a string.

        2) See the SAM Manual, specifically the definition of ISIZE (outer coordinates).

        Comment

        • sunnyvu
          Member
          • Mar 2010
          • 17

          #5
          Thanks.

          I tried this "./samtools view -S -t -X -o exampl.flag accepted_hits.sam"
          I got the error:
          The tag [ID] required for [PG] not present.
          Segmentation fault.

          The title of "accepted_hits.sam":
          @HD VN:1.0 SO:sorted
          @PG TopHat VN:1.0.13
          Did I do something wrong when I ran TopHat?

          Comment

          • nilshomer
            Nils Homer
            • Nov 2008
            • 1283

            #6
            Originally posted by sunnyvu View Post
            Thanks.

            I tried this "./samtools view -S -t -X -o exampl.flag accepted_hits.sam"
            I got the error:
            The tag [ID] required for [PG] not present.
            Segmentation fault.

            The title of "accepted_hits.sam":
            @HD VN:1.0 SO:sorted
            @PG TopHat VN:1.0.13
            Did I do something wrong when I ran TopHat?
            You should report this to the TopHat user list. It looks like the "@PG" line should be:
            Code:
            @PG     ID:TopHat  VN:1.0.13

            Comment

            • sunnyvu
              Member
              • Mar 2010
              • 17

              #7
              You are right.
              Thanks.

              Comment

              • ruping
                Member
                • Jul 2010
                • 11

                #8
                Originally posted by nilshomer View Post
                1) See the SAM Manual, specifically the FLAG field (2nd column). You can use "samtools view -X <sam/bam>" to print the FLAG field into a string.

                2) See the SAM Manual, specifically the definition of ISIZE (outer coordinates).
                About question 2)
                It's still strange because based on ISIZE definition, if the two reads in a pair are mapped to the same reference, ISIZE should be calculated, but here it's 0 for all the cases.

                Does anyone have idea about that?

                Comment

                • shurjo
                  Senior Member
                  • Jan 2009
                  • 132

                  #9
                  Originally posted by nilshomer View Post
                  You should report this to the TopHat user list. It looks like the "@PG" line should be:
                  Code:
                  @PG     ID:TopHat  VN:1.0.13
                  This has been fixed in TopHat v1.0.14.

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                    by SEQadmin2



                    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                    Despite this, “CRISPR helped turn genome editing from a specialized technique into
                    ...
                    07-31-2026, 11:01 AM
                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 08-13-2026, 12:22 PM
                  0 responses
                  30 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-11-2026, 10:35 AM
                  0 responses
                  24 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-06-2026, 07:41 AM
                  0 responses
                  38 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-03-2026, 10:13 AM
                  0 responses
                  51 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...