Hello from Sunny

[sunnyvu]

Hi everyone

I am new to the forum. I have just started to analyze the RNAseq data. I am a little confused on the "accepted_hits.sam" from Tophat. How to interpret this file? What kinds of informaiton does this file contain? Thanks in advance.

[ECO]

Welcome! I assume you've read the TopHat manual?

http://tophat.cbcb.umd.edu/manual.html

[sunnyvu]

Yes, I had read the manual previously. Today I spent all day to figure out the meaning for each column in "accepted_hits.sam" file. First I want to thank the members in this community. I read lots of posts and they are so useful and helpful. I still have two questions.

1) based on the results in ""accepted_hits.sam", how to decide which is right-read and left-read.
HWI-EAS266_0005:1:1:1295:1179#0 113 chr1 554327 255 43M = 40043719 0 GGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGC BBBBBBBBBBBBBBBBBB```````````````KKLHFEEFHO NM:i:0
HWI-EAS266_0005:1:1:1561:15347#0 163 chr1 554418 255 43M = 554511 0 AATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATAA bbbbbbbbbbbbabbbbbbbbbbbabbbbabbabbbbbbbb`_ NM:i:1
HWI-EAS266_0005:1:1:1330:2415#0 163 chr1 554438 255 43M = 554556 0 CAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACC bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb\ba^ NM:i:2
2) We conducted the pair-end sequencing, I provided both end sequences in the command (/tophat -r 70 -o <..> hg18 s1_1_sequence.txt s_1_2_sequence.txt). Why is the ISIZE 0 not the second position subtract the first position?
Thanks,

[nilshomer]

Yes, I had read the manual previously. Today I spent all day to figure out the meaning for each column in "accepted_hits.sam" file. First I want to thank the members in this community. I read lots of posts and they are so useful and helpful. I still have two questions.

1) based on the results in ""accepted_hits.sam", how to decide which is right-read and left-read.
HWI-EAS266_0005:1:1:1295:1179#0 113 chr1 554327 255 43M = 40043719 0 GGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGC BBBBBBBBBBBBBBBBBB```````````````KKLHFEEFHO NM:i:0
HWI-EAS266_0005:1:1:1561:15347#0 163 chr1 554418 255 43M = 554511 0 AATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATAA bbbbbbbbbbbbabbbbbbbbbbbabbbbabbabbbbbbbb`_ NM:i:1
HWI-EAS266_0005:1:1:1330:2415#0 163 chr1 554438 255 43M = 554556 0 CAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACC bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb\ba^ NM:i:2
2) We conducted the pair-end sequencing, I provided both end sequences in the command (/tophat -r 70 -o <..> hg18 s1_1_sequence.txt s_1_2_sequence.txt). Why is the ISIZE 0 not the second position subtract the first position?
Thanks,

1) See the SAM Manual, specifically the FLAG field (2nd column). You can use "samtools view -X <sam/bam>" to print the FLAG field into a string.

2) See the SAM Manual, specifically the definition of ISIZE (outer coordinates).

[sunnyvu]

Thanks.

I tried this "./samtools view -S -t -X -o exampl.flag accepted_hits.sam"
I got the error:
The tag [ID] required for [PG] not present.
Segmentation fault.

The title of "accepted_hits.sam":
@HD VN:1.0 SO:sorted
@PG TopHat VN:1.0.13
Did I do something wrong when I ran TopHat?

[nilshomer]

Thanks.

I tried this "./samtools view -S -t -X -o exampl.flag accepted_hits.sam"
I got the error:
The tag [ID] required for [PG] not present.
Segmentation fault.

The title of "accepted_hits.sam":
@HD VN:1.0 SO:sorted
@PG TopHat VN:1.0.13
Did I do something wrong when I ran TopHat?

You should report this to the TopHat user list. It looks like the "@PG" line should be:

@PG     ID:TopHat  VN:1.0.13

[sunnyvu]

You are right.
Thanks.

[ruping]

1) See the SAM Manual, specifically the FLAG field (2nd column). You can use "samtools view -X <sam/bam>" to print the FLAG field into a string.

2) See the SAM Manual, specifically the definition of ISIZE (outer coordinates).

About question 2)
It's still strange because based on ISIZE definition, if the two reads in a pair are mapped to the same reference, ISIZE should be calculated, but here it's 0 for all the cases.

Does anyone have idea about that?

[shurjo]

You should report this to the TopHat user list. It looks like the "@PG" line should be:

@PG     ID:TopHat  VN:1.0.13

This has been fixed in TopHat v1.0.14.