Announcement

Collapse
No announcement yet.

How to determine 454 paired end adaptor sequence

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • How to determine 454 paired end adaptor sequence

    I have a list of 454 sequence data read, for running the preprocessing step, I need to find out the adaptor sequence read first.
    Do anybody know how to find out the adaptor sequence for the 454 paired-end sequence?
    Is it 454 company using a standard adaptor sequence for all of their sequencing process technique?

  • #2
    Passing on some information from a contact at Sanger regarding the paired end linker sequence:

    454flx
    GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
    (palindromic)

    454titanium
    TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
    (and also check for its reverse complement)

    These are also given in the sffToCA documentation for the WGS assembler:
    http://sourceforge.net/apps/mediawik...matting_Inputs
    Last edited by maubp; 09-30-2009, 01:13 AM. Reason: fixing typo

    Comment


    • #3
      Thanks a lot for your explanation.
      Do you have the list of paired-end adaptor sequence that using by 454 sequencing technique?
      Can provide the suitable link or website for me to find out the paired-end adaptor sequence that using by 454 sequencing technique?
      Thanks a lot for your help

      Originally posted by maubp View Post
      Passing on some information from a contact at Sanger regarding the paired end linker sequence:

      454flx
      GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
      (palindromic)

      454titanium
      TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
      (and also check for its reverse complement)

      These are also given in the sffToCA documentation for the WGS assembler:
      http://sourceforge.net/apps/mediawik...matting_Inputs

      Comment


      • #4
        The MIRA documentation gives a few adaptors, but warns that local sequencing centers may use their own specific ones:
        http://chevreux.org/uploads/media/mi...tml#section_10

        Comment


        • #5
          Hi, thanks a lot again
          Do you have any idea about the adaptor sequence using by 454 technique to sequence bacillus genome?

          Originally posted by maubp View Post
          The MIRA documentation gives a few adaptors, but warns that local sequencing centers may use their own specific ones:
          http://chevreux.org/uploads/media/mi...tml#section_10

          Comment


          • #6
            Are you talking about getting your own data for bacillus by paying a local sequencing service? If so, your sequencing center should be able to tell you the adaptor/linker sequences they use - but it will probably be the default Roche 454 sequences.

            Comment


            • #7
              For 454 FLX sequencing data,

              The sequence below is it the general 454 flx adaptor sequence?
              454flx
              GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
              (palindromic)

              When I using it because of palindromic, should I used this:

              >454flx1
              GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC

              >454flx2
              CAACCTTGGCTTTCCCAAACTTAAGTTTGGGAAAGCCAAGGTTG

              I just checked, my data is 454 flx sequencing data, just I not sure about its adaptor sequence used for 454 flx.
              Thanks for your help
              Originally posted by maubp View Post
              Are you talking about getting your own data for bacillus by paying a local sequencing service? If so, your sequencing center should be able to tell you the adaptor/linker sequences they use - but it will probably be the default Roche 454 sequences.

              Comment


              • #8
                Originally posted by edge View Post
                For 454 FLX sequencing data,

                The sequence below is it the general 454 flx adaptor sequence?
                454flx
                GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
                (palindromic)
                No - that is the linker sequence used for paired end reads.

                Comment


                • #9
                  thanks a lot, I get it d
                  you are administrator,right?!
                  thanks for your guide so far

                  Originally posted by maubp View Post
                  No - that is the linker sequence used for paired end reads.

                  Comment


                  • #10
                    Originally posted by edge View Post
                    thanks a lot, I get it d
                    you are administrator,right?!
                    thanks for your guide so far
                    No, I'm not a forum admin - just another user.

                    I'm sorry if I added to the confusion by talking about the paired end linker sequences when you were more interested in the adapter sequences. Hopefully things are clearer now

                    Comment


                    • #11
                      haha..
                      thanks a lot for your help
                      Actually I confusing myself d...
                      I refer to the paired-end linker instead of paired-end adaptor sequence
                      I misunderstanding myself d
                      Besides that, do you familiar with some open source software, like SSAHA2?!

                      Originally posted by maubp View Post
                      No, I'm not a forum admin - just another user.

                      I'm sorry if I added to the confusion by talking about the paired end linker sequences when you were more interested in the adapter sequences. Hopefully things are clearer now

                      Comment

                      Working...
                      X