File format

[kylle345]

Hi,

I have a sequencing file that looks like this:

4_1_932_784 GGACAGTTTTTTCCAATTATGGAACGCCTGTTCCTG
4_1_829_103 GTCACTATCTCAGTCAAAATTTAAGAAAATTGACAT
4_1_450_206 GTGCTATATCCCTATATAACCTACCCATCCACCTTT
4_1_495_275 GTTGTGGGAAATTGGAGCGATAAGCGTGCTTCTTCC

It is different from the standard fastq format. Does anyone know what format this is called?

[ECO]

Check this thread:

http://seqanswers.com/forums/showthread.php?t=418

[kylle345]

Hey thanks for the reply but..

But I only have the .seq file and not the .prb file.

Does anyone know how to only handle the .seq file?

thanks

[ECO]

What do you want to do with the .seq file? Convert to fasta? fastq?

[kylle345]

Hi sorry,

I want to convert to it a fastq file.

[nilshomer]

Hi sorry,

I want to convert to it a fastq file.

The *seq.txt files from my observations do not have qualities so you will have to make dummy quality values. For single end data, you could do something like:

awk '{printf("@%d:%d:%d:%d\n%s\n+\n", $1, $2, $3, $4, $5); 
for(i=0;i<length($5);i++) { printf("I"); }; 
printf("\n")}' 
s_1_0001_seq.txt

For paired end data, they concatenate the two reads so it is a little more complicated using awk but the above should get you started.

[kylle345]

so that will help me create a .prb file?

Hey thanks for the quick replies. So having a .seq file is not enough to make a fastq file so that awk line helps me create a .prb file from .seq?

then the combination of .seq and .prb can create a fastq?

thanks

[nilshomer]

Hey thanks for the quick replies. So having a .seq file is not enough to make a fastq file so that awk line helps me create a .prb file from .seq?

then the combination of .seq and .prb can create a fastq?

thanks

The .seq file does not store qualities, so the qualities will have not have any meaning. The above awk command will output in FASTQ format so you do not need to worry about .seq and .prb files.

If you have .qseq files (or .seq and .prb which you seem to be missing), then you can make a meaningful fastq file.

[kylle345]

Hi I tried the awk line but it does not place the sequences in the new file.

I tried awk '{printf("@%d:%d:%d:%d\n%s\n+\n", $1, $2, $3, $4, $5); for(i=0 file1.txt > file2.txt

the output file only contains

@1:0:0:0

+

@1:0:0:0

+

@1:0:0:0


Its missing the sequence in between the lines.... is there something missing?

[nilshomer]

I tried awk '{printf("@%d:%d:%d:%d\n%s\n+\n", $1, $2, $3, $4, $5); for(i=0 file1.txt > file2.txt

the output file only contains

@1:0:0:0

+

@1:0:0:0

+

@1:0:0:0


Its missing the sequence in between the lines.... is there something missing?

I must admit I am an author of the alignment program BFAST (free for academic use), which does have a "qseq2fastq.pl" perl script. It may be easier to rely on such a script.

[kylle345]

thanks

Hey,

I will check it out

Kyle