Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Dual indexing construct for MiSeq - where to put the barcode for index2?

    We would like to use the second indexing read on the MiSeq for amplicon sequencing (not using the Illumina Custom Amplicon Sequencing). Has anyone successfully designed the adaptors containing index2? Where would you put the barcodes?
    I assume "TrueSeq Universal Adapter" from the "Illumina-Customer-Sequence-Letter" would be the sequence to start.
    Thanks
    Vinz

  • #2
    Hi Vinz, I looked into this and the information that Illumina distributes to customers does not contain the full length adapter sequences as far as I know. You might also be interested in this thread where csquared helpfully suggested that the 2nd barcode is inside the other adapter and is primed directly from the flowcell annealing sequence. Reading Illumina's instrument operation manuals appears to confirm this, they suggest there are some chemistry-only dark cycles prior to reading the other index in their standard protocol and these presumably synthesize the bases between the flow cell annealing region and the index region.

    However, if you are doing amplicon sequencing you probably have the flexibility to design your own sequencing primers in which case you might be able to follow a design like what Kircher et al have described. That would have the advantage of not wasting 9 cycles of reagents.

    Comment


    • #3
      Thanks for the link to the paper of Kircher et al. That is indeed helpful.
      The way the 2nd barcode is sequenced is nicely described in the Dual Indexing Training for all that have access. It just does not show any sequences.

      Comment


      • #4
        The video in that training is the best explanation I've seen yet of the dual index adapter structure and sequencing process. Interesting that the 2nd index is sequenced while the template molecule is bridged. Thanks Vinz!

        Comment


        • #5
          Hey guys. I'm in the process of making my own Truseq-esque double indexing adapters for MiSeq, and (as you've seen) Illumina will not be forthcoming with the sequences...so I had to figure it out for myself and will share it with you.

          I just sequenced a standard single-indexed TruSeq library with the Nextera/Amplicon protocol and the below describes my observations.
          It may not help with figuring out the nextera sequences but probably contains some information that will help.

          I'm just about to run libraries with my own homebrew double indexing design, will post when/if it turns out well.

          Attached Files

          Comment


          • #6
            Oh and page 5 of this document has as nice diagram of the process, so far the chemistry has seemed the same on the MiSeq.
            Attached Files

            Comment


            • #7
              Meanwhile we figured out how to do the dual indexing.
              What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
              This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...
              This works very well for us on the MiSeq for dual indexing with the primers of the cartridge.

              Comment


              • #8
                Originally posted by ECO View Post
                I'm just about to run libraries with my own homebrew double indexing design, will post when/if it turns out well.
                By "homebrew," do you mean that you were using custom Read 1, i7 index and Read 2 primers? I am contemplating this strategy for dual indexed amplicons in order to avoid sequencing the constant regions that anneal to the PCR template.

                Either way, how did it turn out?

                Comment


                • #9
                  MiSeq Dual-indexing

                  Originally posted by Vinz View Post
                  Meanwhile we figured out how to do the dual indexing.
                  What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
                  This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...
                  This works very well for us on the MiSeq for dual indexing with the primers of the cartridge.
                  I have a library design based on Kirchner et al. as well and I'm planning to run it on the MiSeq. So, did you have to tweak the sample sheet of the MiSeq or did you use the standard Nextera program? Maybe you could even share your sample sheet here?

                  Thanks,
                  seq_yak
                  Last edited by seq_yak; 06-19-2012, 07:24 AM. Reason: a lot of typos

                  Comment


                  • #10
                    I have attached a recent sample sheet example.
                    The sequence of index1 (I7) needs to be reverse complemented of what you ordered as primer. The sequence of index2 is just as the primer was synthesized.
                    However, this will use the index and read primers of the cartridge. If you want to add your own primers you need to add this information.
                    Attached Files

                    Comment


                    • #11
                      Does that mean that using the following primers you could create your own dual indexed amplicon library?

                      AATGATACGGCGACCACCGAGA{TCTACAC}[i5 index][custom fwd]
                      CAAGCAGAAGACGGCATACGAGAT[i7 index][custom rev]

                      Dark cycles in curly brackets{ }
                      Read 1 with custom fwd
                      Index i7 with reverse compliment of custom rev
                      Index i5 same as Illumina's
                      Read 2 with custom rev

                      We'd be very interested in this for potential 16s studies as could then feasibly multiplex 96, or even 384 samples in one MiSeq run.

                      Comment


                      • #12
                        I think this should do it.

                        Comment


                        • #13
                          Originally posted by Vinz View Post
                          I have attached a recent sample sheet example.
                          The sequence of index1 (I7) needs to be reverse complemented of what you ordered as primer. The sequence of index2 is just as the primer was synthesized.
                          However, this will use the index and read primers of the cartridge. If you want to add your own primers you need to add this information.
                          Hi Vinz,

                          thanks for the input. So, if I understood you right you're able to use the primers of the cartridge and the sample sheet you posted to sequence such a TruSeq-esque library (attached)?
                          Attached Files

                          Comment


                          • #14
                            Hi seq_yak,
                            yes, with the design you attached things should work well. You do not need to add additional primers and with the sample sheet MiSeq should give you nice sequences. Good luck!

                            Comment


                            • #15
                              Originally posted by Vinz View Post
                              Meanwhile we figured out how to do the dual indexing.
                              What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
                              This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...
                              So that would be a hemi-methylated DpnI site? With the flowcell oligo contributing the methylated adenine required for DpnI to cut?

                              --
                              Phillip

                              Comment

                              Latest Articles

                              Collapse

                              • seqadmin
                                Best Practices for Single-Cell Sequencing Analysis
                                by seqadmin



                                While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                                06-06-2024, 07:15 AM
                              • seqadmin
                                Latest Developments in Precision Medicine
                                by seqadmin



                                Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                                Somatic Genomics
                                “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                                05-24-2024, 01:16 PM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by seqadmin, Yesterday, 07:24 AM
                              0 responses
                              10 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 06-13-2024, 08:58 AM
                              0 responses
                              11 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 06-12-2024, 02:20 PM
                              0 responses
                              16 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 06-07-2024, 06:58 AM
                              0 responses
                              184 views
                              0 likes
                              Last Post seqadmin  
                              Working...
                              X