[cli]

I just did my duel index sequencing on miseq. It returned nice results. Here is the index primer (primer for indexing PCR) I used:

P7 Index CAAGCAGAAGACGGCATACGAGATgctaacgcGTGACTGGAGTTCAGACGTGT
P5 Index AATGATACGGCGACCACCGAGATCTACACgctaacgcACACTCTTTCCCTACACGACGCTCTT

Here is the sample sheet I used for the run:

[Header]
IEMFileVersion 4
Date 12/10/14
Workflow GenerateFASTQ
Application FASTQ Only
Assay TruSeq HT
Description
Chemistry Amplicon

[Reads]
251
251

[Settings]
ReverseComplement 0
Adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

[Data]
Sample_ID Sample_Name Sample_Plate Sample_Well I7_Index_ID index I5_Index_ID index2 Sample_Project Description
1 A11 Index517 GCGTTAGC IS4_517 GCTAACGC

…

Hope this helps

[monia]

indexed primer

hi everybody, i will apply the Miseq staregy but i didn't understand how to prepare the indexed primer from my initial primer?!!

[DNA_Dan]

However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.

Regarding this comment from a while back - if your target is a PCR amplicon product and the ends are all the same primer sequences, isn't the ONLY way to successfully sequence this is through a custom sequencing primer?

Otherwise you'd be sequencing a pool of homogeneous ends for the length of your PCR primers, right? (Unless your pool is made of products that came from multiple primer sets.)

[nucacidhunter]

I still have some questions about the turn-around business though. After the i7 indexing read, the other strand would be synthesized along with i5 index sequenced after 7 dark cycles. Should the full length of the new strand be fully extended before the read 2 sequencing started, because the full strand is needed as sequencing template for read2? If so, where are the consumable (dNTPs etc.) come from? Are those also contained in the reagent cartridge? It shouldn't be part of the reagents for 200bp reads, should it? I feel I might sound silly, but those questions keep annoying me if I can't find an answer.

After last cycle of 2nd index read, it is stripped away and new strand synthesis starts and reagents for it are in the sequencing kit components. If you want to make sure that your sequencing will be successful, you need to provide more information about your experiment design and protocol and ....

I wonder how you ended up having the same priming site in both strands.

[cli]

GenoMax, thanks for the information. Nucacidhunter, thank for explaining the chemistry. This is really cool! Now feel more comfortable to try customized sequencing primers. Since each time there is only one strand interrogated for sequencing, even my sequencing primer could anneal to both strand, it should not cause any problems.

I still have some questions about the turn-around business though. After the i7 indexing read, the other strand would be synthesized along with i5 index sequenced after 7 dark cycles. Should the full length of the new strand be fully extended before the read 2 sequencing started, because the full strand is needed as sequencing template for read2? If so, where are the consumable (dNTPs etc.) come from? Are those also contained in the reagent cartridge? It shouldn't be part of the reagents for 200bp reads, should it? I feel I might sound silly, but those questions keep annoying me if I can't find an answer.

[nucacidhunter]

If it is correct, I'd like to know how the p5 and p7 tethered stands were cut?

If you are looking for chemistry used for cleavage of strands during sequencing, I have got following from a rather old paper:

Immobilised oligos on paired end Flowcell surface:

Oligo ‘C’: 5’-PS-TTTTTTTTTTAATGATACGGCGACCACCGAGAUCTACAC-3’
(U = 2-deoxyuridine), Linearization of oligo C with “USER” enzyme retains strand 1, attached to “D” oligo.

Oligo ‘D’: 5’-PS-TTTTTTTTTTCAAGCAGAAGACGGCATACGAGoxoAT-3’,
(Goxo = 8-oxoguanine) Second strand is cleaved at the 8-oxoguanine in oligo 'D' using Fpg enzyme.

[GenoMax]

Since you can't see the video how about this link: http://nextgen.mgh.harvard.edu/IlluminaChemistry.html

[cli]

Indeed, my customized adapter and sequencing primer is the same for read1 and read2. So if the sequencing is done from one direction, it would be fine. But if the cluster is composed of two opposite strands when sequencing is done, then my sequencing primer could anneal to both stands and my reads would be a mess. I'd really like to find out if the opposite stands are clipped off from the cluster for both read 1 and read2? Thanks

[cli]

Thank you, GenoMax. I am ashamed to say that I can't open any youtube link, because I am in China now. If anyone could explain to me how it works in simple words, it'll be greatly appreciated. I am sorry for being so ignorant.

[cli]

Hi, Creeves, thank you for your reply. I understand that after the cluster generation, there would be a mixture of complementary strands grow from the p5 or p7 ends. Some documents suggested the strands with p5 ends attached to the flow cell would be stripped off for the first read and the i7 index read to ensures "that all copies are sequenced in the same direction". Then, after the turn around, the p7 grafted strands would be cleaved to allow all reads of read 2 come off the p5 tethered stands. Does this sound correct? If it is correct, I'd like to know how the p5 and p7 tethered stands were cut?

Here is the link where I got the information:

http://nextgen.mgh.harvard.edu/IlluminaChemistry.html

[GenoMax]

Illumina has a simplified animation for cluster generation/sequencing available here: http://www.youtube.com/watch?v=HMyCqWhwB8E

[creeves]

If I understand your question, it suggests you do not understand the process of cluster formation. After denaturing the library fragments for loading, one strand can hybridize to the p5 oligo on the flow cell and the other can hybridize to the p7 oligo. Bridge amplification can proceed for both strands as long as the strands come from a library fragment with p5 on one end and p7 on the other. If a strand can hybridize to p5, the p7 end of that strand is not complementary to the p7 oligo on the flow cell. Likewise, if a strand can hybridize to p7, the p5 end is not complementary to the p5 oligo on the flow cell. However, once the first extension is complete for either case and the untethered strand is washed away, the distal end is now able to hybridize to the other oligo on the flow cell. Whichever end first hybridizes (p5 or p7) the cluster ends up being an equal mixture of complementary strands tethered at the p5 or p7 ends.

[cli]

I have studied this thread of posts, but I still have a few questions that confuse me.

I understand that the p5 connected fragments are grafted at the uracil site after bridging amplification but before the first read. My question is that, after the turnaround, there would be both p5 and p7 connected fragments. Does the p7 connected fragments need to be cut off or removed before the second read? If so, how does it carried out?

[Vinz]

We have done up to 1536 multiplexing in a run so far. Demultiplexing by the MiSeq software worked well.
However, there is a bug in the current RTA version: There is a timeout for writing fastqs in the output folder. For large V3 runs with many samples, part of the fastqs do not end up in the output folder. They are however in the analysis folder.

Meanwhile we published our dual indexing strategy - in case anyone is interested:
BMC Genomics - Cost-efficient high-throughput HLA typing by MiSeq amplicon sequencing

[GenoMax]

Was this V2/V3 chemistry and what was the cluster concentration? I wonder if the problems you are having are because of overloading and not number of samples.