[ThePhotosyntheticMan]

I think both should work.
The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.

Got it. Thanks!

[TonyBrooks]

I think both should work.
The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.

[ThePhotosyntheticMan]

Hi all, I'm new to NGS so approach this post with a healthy dose of skepticism.

I'm in the process of designing PCR primers for a targeted approach to sequencing dual indexed amplicons on the MiSeq. After reading ECO's posts, this is what I've deduced about primer design:

FORWARD PCR PRIMER:
5’ – AATGATACGGCGACCACCGAGA{TCTACAC}nnnnnnnnACACTCTTTCCCTACACGACGCTCTTCCGATCT[Forward primer sequence]
REVERSE PCR PRIMER:
5’ – CAAGCAGAAGACGGCATACGAGATnnnnnnnnGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT[Reverse primer sequence]

...where bold = i5 and i7 indices, respectively.

This confuses me because the sequences following the indices are different from those introduced by the transposon. According to Illumina's Customer Sequence Letter, a targeted PCR strategy that mimics samples prepped using Nextera would have primers that appear as follows:

FORWARD PCR PRIMER:
5' - AATGATACGGCGACCACCGAGA{TCTACAC}nnnnnnnnTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[Forward primer sequence]
REVERSE PCR PRIMER:
5’ – CAAGCAGAAGACGGCATACGAGATnnnnnnnnGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[Reverse primer sequence]

...which would mean Read 1, Index 1, and Read 2 sequencing primers are different, hence my confusion. Will either of these strategies work on the MiSeq? Has the above strategy worked for some folk? My thanks in advance.

[ECO]

I could definitely be wrong though!! It seems crazy to rely on restriction when more specificity would be achieved by uracil dependent cleavage.

The flow cell primer having a uracil at that position is a bit of a clue too...assuming that info is correct.

[Vinz]

So that would be a hemi-methylated DpnI site? With the flowcell oligo contributing the methylated adenine required for DpnI to cut?

--
Phillip

Hi Philip,
that was the idea. But ECO pointed out that it is probably uracil at some position and some uracil dependant cleavage.

[ECO]

Ok sorry for the delay all...please see attached document for my results/experience. There is a review of standard truseq, the design that I came up with with help from this thread, and an example samplesheet.

Everything comes with my standard disclaimer of "if you don't know what you're doing you WILL mess something up" and...this is based on one successful run of testing...so this is very experimental.

[pmiguel]

Meanwhile we figured out how to do the dual indexing.
What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...

So that would be a hemi-methylated DpnI site? With the flowcell oligo contributing the methylated adenine required for DpnI to cut?

--
Phillip

[Vinz]

Hi seq_yak,
yes, with the design you attached things should work well. You do not need to add additional primers and with the sample sheet MiSeq should give you nice sequences. Good luck!

[seq_yak]

I have attached a recent sample sheet example.
The sequence of index1 (I7) needs to be reverse complemented of what you ordered as primer. The sequence of index2 is just as the primer was synthesized.
However, this will use the index and read primers of the cartridge. If you want to add your own primers you need to add this information.

Hi Vinz,

thanks for the input. So, if I understood you right you're able to use the primers of the cartridge and the sample sheet you posted to sequence such a TruSeq-esque library (attached)?

[Vinz]

I think this should do it.

[TonyBrooks]

Does that mean that using the following primers you could create your own dual indexed amplicon library?

AATGATACGGCGACCACCGAGA{TCTACAC}[i5 index][custom fwd]
CAAGCAGAAGACGGCATACGAGAT[i7 index][custom rev]

Dark cycles in curly brackets{ }
Read 1 with custom fwd
Index i7 with reverse compliment of custom rev
Index i5 same as Illumina's
Read 2 with custom rev

We'd be very interested in this for potential 16s studies as could then feasibly multiplex 96, or even 384 samples in one MiSeq run.

[Vinz]

I have attached a recent sample sheet example.
The sequence of index1 (I7) needs to be reverse complemented of what you ordered as primer. The sequence of index2 is just as the primer was synthesized.
However, this will use the index and read primers of the cartridge. If you want to add your own primers you need to add this information.

[seq_yak]

MiSeq Dual-indexing

Meanwhile we figured out how to do the dual indexing.
What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...
This works very well for us on the MiSeq for dual indexing with the primers of the cartridge.

I have a library design based on Kirchner et al. as well and I'm planning to run it on the MiSeq. So, did you have to tweak the sample sheet of the MiSeq or did you use the standard Nextera program? Maybe you could even share your sample sheet here?

Thanks,
seq_yak

[gnomers]

I'm just about to run libraries with my own homebrew double indexing design, will post when/if it turns out well.

By "homebrew," do you mean that you were using custom Read 1, i7 index and Read 2 primers? I am contemplating this strategy for dual indexed amplicons in order to avoid sequencing the constant regions that anneal to the PCR template.

Either way, how did it turn out?

[Vinz]

Meanwhile we figured out how to do the dual indexing.
What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...
This works very well for us on the MiSeq for dual indexing with the primers of the cartridge.