[mchikri]

Hi
I m new and happy to be part of seqanswers
I hope to learne and to be also usful
mchikri

[costamc]

Hi,
I've been trying to sequence the V3-V4 region of the 16S gene was hoping touse my forward and reverse primers as my sequencing primers and the reverse compliment of the reverse primer as my index primer. The problem I just found during a real time PCR to determine sequencing primer efficiency is that the primers will not bind their targets efficiently at the required temperature (65oC).
We can easily increase the length of the sequencing primers going back into the Illumina adapters, but I am afraid that when I increase the length of the index primer I will end up out of the conservative region. I've tried including several degeneracies, but the lowest Tm is never higher than 65oC.
the reverse primer I choose is the S-D-Bact-0785-a-A-21: 5′-GACTACHVGGGTATCTAATCC-3

I appreciate any ideas or comments.

Marcio.

[tldgID]

This is a great comparison protist! thank you!

[protist]

Thanks protist! not sure what 'legacy Illumina adapters' are thought! and I couldn't find any information about them on Illumina website or customer letter. But anyways, thanks.

The original adapters (what I called legacy) released by Illumina are not exactly the same sequence as the currently in use TruSeq adapters - e.g. old adapters did not have indexes TruSeq ones do. The sequences for the individual TruSeq adapters can be found in the Illumina customer letter (see attached) which can also be downloaded from the Illumina website. I have also attached an alignment I had illustrating the differences between the original adapters and the currently in use TruSeq adapters.

[tldgID]

The library schematic you are looking at is for legacy Illumina adapters not the the TruSeq versions. The original adapters required a PCR step to add the portion of the library that attaches to the Flowcell. The True Seq adapters are complete and there are some sequence differences to the original non-True Seq versions - check the Illumina customer letter for the correct sequemces.

Thanks protist! not sure what 'legacy Illumina adapters' are thought! and I couldn't find any information about them on Illumina website or customer letter. But anyways, thanks.

[protist]

Hi all,

Can anyone point me to a reference for this sequence? following the Illumina TruSeq kit, the final PE TruSeq product doesn't look like this for me. Especially for the top read, after the Ns, where the 3' adapter is, seems to be different.

Really appreciate any feedback!

The library schematic you are looking at is for legacy Illumina adapters not the the TruSeq versions. The original adapters required a PCR step to add the portion of the library that attaches to the Flowcell. The True Seq adapters are complete and there are some sequence differences to the original non-True Seq versions - check the Illumina customer letter for the correct sequemces.

[tldgID]

Sorry for the small font, but that's the only way I could make it fit


Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
PE PCR Primer1:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
Result Library:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
PE DNA Sequencing Primer1
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE DNA Sequencing Primer2
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'

Hi all,

Can anyone point me to a reference for this sequence? following the Illumina TruSeq kit, the final PE TruSeq product doesn't look like this for me. Especially for the top read, after the Ns, where the 3' adapter is, seems to be different.

Really appreciate any feedback!

[soban]

Hi, what is the range of DNA reduced representation libraries sequence length, its 200-300bp, the older one, what is the newer length range?.

[bluescapebioo]

thanks a lot

[Zebrafish]

PE primers

Hi,

I am looking for PE primer 1.0 and primer 2.0 sequences that people have good experience with. There is too much confusion whether these primers need to be modified at 3' (LCNA or phosphothioate).

Can anyone share exact modifications for primers and their sequences? I already have lot of adapters that come with PE oligo kit but ran out of primers.

Thanks
Shob

[cosmarium]

I found this page, maybe this is what you are looking for? I hope this helps:

http://intron.ccam.uchc.edu/groups/tgcore/wiki/013c0/Solexa_Library_Primer_Sequences.html

Best,

C

[aleferna]

Hi it seems they changed the sequence of the MiSeq adapters in the new Nextera Kit, anybody knows what is the sequence of the indexing adapters in the new Nextera kits?

[frc1230]

I think in principle you are right, as far as I know. I can't personally see any reason why it would be advantageous to switch the order of synthesis of the two arms, and without a compelling reason I would not mess with the system.

[Akira]

During PCR amplification, the primer2.0 will first bind to P7 region, synthesize the 1st PCR product, then only primer1.0 will be able to bind to its complement at P5 region, am I right?

What if I want the P7 region to be synthesized later, after the 1st strand?

Just out of curiosity, if the Y-adapter now is the reverse complement of the original single-stranded sequence, any chances it will form hairpin or any undesirable product, if now the Y-adapter is stable, the reverse complement of it will be stable as well, no?

Sorry for the poor English btw.

[frc1230]

As I understand it, the single-stranded sequences in the Y-adapter must match the sequences immobilized on the chip. One must be identical to one of the chip sequences, and the other must be the reverse complement of the other. I suppose in principle you could switch around which pairs with which. I can't see any advantage to doing this, though, and there could well be problems since this system is very specific (amazing to me that it works at all).