Seqanswers Leaderboard Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • nanos
    Member
    • May 2010
    • 11

    #61
    hi!!

    i would like to use custom adaptors to do ChiP sequencing.

    for this i would need to know what the concentration of the adaptor for this protocol is.

    thanks for your help

    Comment

    • AdamB
      Member
      • Apr 2010
      • 43

      #62
      Quick FYI. I spent many hours trying to get the PCR amplification working with Sigma primers (with the phosphorothioate bond), but with very low yields. After switching to the Illumina-supplied primers, my yield shot up.

      What suppliers for primers have people used, where they found the custom primers to work properly?

      Comment

      • kmcarr
        Senior Member
        • May 2008
        • 1181

        #63
        What suppliers for primers have people used, where they found the custom primers to work properly?

        IDT

        (now some jibberish to meet the 10 character minimum for posting)

        Comment

        • NextGenSeq
          Senior Member
          • Apr 2009
          • 482

          #64
          I don't see anyone mentioning the two locked nucleic acid (LNA) bases in the primers. People have told me that this dramatically increases library yields.

          Comment

          • AdamB
            Member
            • Apr 2010
            • 43

            #65
            Originally posted by kmcarr View Post

            IDT

            (now some jibberish to meet the 10 character minimum for posting)
            Thanks, and did you have the phosphorothioate bonds at the 3' end?

            Comment


            • #66
              Originally posted by sci_guy View Post
              The P.E adaptors/primers have been added at the original link.
              I have ordered Illumina's paired end primers and had low yield of PCR amplicons of my library. I was sent supplemental information from this nature paper. http://www.nature.com/nature/journal...re07517-s1.pdf

              This states that the PCR primers should have a phosphorothioate bond at the 3' end:

              5’-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGC
              TCTTCCGATCxT and 5’-
              AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT
              CCGATCxT (x = phosphorothioate bond resistant to excision by 3’-5’ exonucleases).

              This is the first I am hearing of this. Should the Paired End PCR Primers be modified in such a way?

              Comment

              • pedstunite
                Junior Member
                • Jul 2010
                • 1

                #67
                overhang on adapters not for ligation purposes

                Hi,

                I have the same question regarding the adapter sequence. I can't understand why there is an overhang on the 5' end of an illumina adapter sequence (not the overhang needed for ligation). B/c this sequence is amplified by PCR anyways, I don't see the need for an overhang. Anyone know???

                Thx

                Comment

                • NextGenSeq
                  Senior Member
                  • Apr 2009
                  • 482

                  #68
                  Originally posted by clz8782 View Post
                  I have ordered Illumina's paired end primers and had low yield of PCR amplicons of my library. I was sent supplemental information from this nature paper. http://www.nature.com/nature/journal...re07517-s1.pdf

                  This states that the PCR primers should have a phosphorothioate bond at the 3' end:

                  5’-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGC
                  TCTTCCGATCxT and 5’-
                  AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT
                  CCGATCxT (x = phosphorothioate bond resistant to excision by 3’-5’ exonucleases).

                  This is the first I am hearing of this. Should the Paired End PCR Primers be modified in such a way?
                  I believe this is because they use proof-reading polymerase in the PCR reaction. We use locked nucleic acids instead of phosphorothioate modifications since this is what the Tufts protocol recommends. If you don't modify the primers the yield will be much lower.

                  Comment

                  • edge
                    Senior Member
                    • Sep 2009
                    • 199

                    #69
                    Hi,

                    Does anybody got the idea regarding the adaptor sequence use for small RNA seq data of ILLUMINA IDEA CHALLENGE?

                    Thanks a lot for sharing.

                    Comment

                    • edge
                      Senior Member
                      • Sep 2009
                      • 199

                      #70
                      From the following link, http://intron.ccam.uchc.edu/groups/t...Sequences.html

                      Small RNA oligonucleotide sequences
                      5' RNA Adapter
                      5' GUUCAGAGUUCUACAGUCCGACGAUC

                      3' RNA Adapter
                      5' P-UCGUAUGCCGUCUUCUGCUUGUidT

                      Do I need to convert the "U" to "T" before I start trimming the adaptor sequence in my raw data?
                      Besides that, what is the "id" in 3' RNA Adapter refer to?
                      Thanks for any advice.

                      Comment

                      • MW007
                        Junior Member
                        • Sep 2010
                        • 2

                        #71
                        tru-seq adapters?

                        Does anyone know if the new tru-seq system uses different adapters; i.e. different sequences than those posted below?

                        Comment

                        • genlyai
                          Member
                          • Aug 2009
                          • 39

                          #72
                          MW007, I've heard truseq does use new seqs for some oligos, but I'm not sure which. If anyone can answer this -- possibly we can get a start just from looking at a run that's used Truseq -- that would be great.

                          Another thing I didn't see on here is sequences of the barcode primers (from pre-truseq days). Can anybody help with that?

                          Comment

                          • seqgirl123
                            Member
                            • Oct 2008
                            • 78

                            #73
                            anyone use qPCR primers during library prep?

                            Does anyone use the qPCR primers sold by Applied Biosystems to amplify their PCR product? Their qPCR primer sequences they sell are identical to Illumina's flowcell oligos 'P5' and 'P7'.

                            Taking an example, say you have a genomic paired-end library and for whatever reason, there's low library yield after PCR cleanup. So you decide to reamplify. But instead of reamplifying with the primers again (which is the common route), does anyone use the qPCR primers instead? The reasoning behind it is that your library now contains the regions complementary to flowcell oligos, so the qPCR primers can be used for reamplification instead of the PE-primers. I am not sure how this would help though. Perhaps because the qPCR primers are same as flowcell oligos, they will amplify the material better and thus will lessen PCR bias, and give higher quality sequencing data? Has anyone ever heard of this?

                            On another note, I haven't heard of people using the qPCR primers in place of PE primers however, and not sure if it can be done either. I haven't checked it out myself.

                            Comment

                            • NextGenSeq
                              Senior Member
                              • Apr 2009
                              • 482

                              #74
                              We use the KAPA library quantification kit. It comes with everything you need and works very well.

                              Comment

                              • seqgirl123
                                Member
                                • Oct 2008
                                • 78

                                #75
                                Do you ever use the KAPA GAIIx qPCR primers for library re amplification before putting the library onto the cluster station?

                                Comment

                                Latest Articles

                                Collapse

                                • seqadmin
                                  New Genomics Tools and Methods Shared at AGBT 2025
                                  by seqadmin


                                  This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.

                                  The Headliner
                                  The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...
                                  03-03-2025, 01:39 PM
                                • seqadmin
                                  Investigating the Gut Microbiome Through Diet and Spatial Biology
                                  by seqadmin




                                  The human gut contains trillions of microorganisms that impact digestion, immune functions, and overall health1. Despite major breakthroughs, we’re only beginning to understand the full extent of the microbiome’s influence on health and disease. Advances in next-generation sequencing and spatial biology have opened new windows into this complex environment, yet many questions remain. This article highlights two recent studies exploring how diet influences microbial...
                                  02-24-2025, 06:31 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by seqadmin, 03-20-2025, 05:03 AM
                                0 responses
                                16 views
                                0 reactions
                                Last Post seqadmin  
                                Started by seqadmin, 03-19-2025, 07:27 AM
                                0 responses
                                17 views
                                0 reactions
                                Last Post seqadmin  
                                Started by seqadmin, 03-18-2025, 12:50 PM
                                0 responses
                                18 views
                                0 reactions
                                Last Post seqadmin  
                                Started by seqadmin, 03-03-2025, 01:15 PM
                                0 responses
                                185 views
                                0 reactions
                                Last Post seqadmin  
                                Working...