Seqanswers Leaderboard Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • cosmarium
    Member
    • Mar 2012
    • 18

    I found this page, maybe this is what you are looking for? I hope this helps:



    Best,

    C

    Comment

    • Zebrafish
      Junior Member
      • Jan 2010
      • 5

      PE primers

      Hi,

      I am looking for PE primer 1.0 and primer 2.0 sequences that people have good experience with. There is too much confusion whether these primers need to be modified at 3' (LCNA or phosphothioate).

      Can anyone share exact modifications for primers and their sequences? I already have lot of adapters that come with PE oligo kit but ran out of primers.

      Thanks
      Shob

      Comment

      • bluescapebioo
        Junior Member
        • Feb 2012
        • 3

        thanks a lot

        Comment

        • soban
          Junior Member
          • Nov 2011
          • 5

          Hi, what is the range of DNA reduced representation libraries sequence length, its 200-300bp, the older one, what is the newer length range?.

          Comment

          • tldgID
            Member
            • May 2011
            • 18

            Originally posted by dandestroy View Post
            Sorry for the small font, but that's the only way I could make it fit


            Paired-end DNA

            PE Adapter1:
            5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
            3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
            PE Adapter2:
            5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
            3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
            PE PCR Primer1:
            5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
            3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
            PE PCR Primer2:
            5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
            3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
            Result Library:
            5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
            3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
            PE DNA Sequencing Primer1
            5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
            3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
            PE DNA Sequencing Primer2
            5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
            3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'

            Hi all,

            Can anyone point me to a reference for this sequence? following the Illumina TruSeq kit, the final PE TruSeq product doesn't look like this for me. Especially for the top read, after the Ns, where the 3' adapter is, seems to be different.

            Really appreciate any feedback!

            Comment

            • protist
              Senior Member
              • Jan 2009
              • 101

              Originally posted by tldgID View Post
              Hi all,

              Can anyone point me to a reference for this sequence? following the Illumina TruSeq kit, the final PE TruSeq product doesn't look like this for me. Especially for the top read, after the Ns, where the 3' adapter is, seems to be different.

              Really appreciate any feedback!
              The library schematic you are looking at is for legacy Illumina adapters not the the TruSeq versions. The original adapters required a PCR step to add the portion of the library that attaches to the Flowcell. The True Seq adapters are complete and there are some sequence differences to the original non-True Seq versions - check the Illumina customer letter for the correct sequemces.

              Comment

              • tldgID
                Member
                • May 2011
                • 18

                Originally posted by protist View Post
                The library schematic you are looking at is for legacy Illumina adapters not the the TruSeq versions. The original adapters required a PCR step to add the portion of the library that attaches to the Flowcell. The True Seq adapters are complete and there are some sequence differences to the original non-True Seq versions - check the Illumina customer letter for the correct sequemces.
                Thanks protist! not sure what 'legacy Illumina adapters' are thought! and I couldn't find any information about them on Illumina website or customer letter. But anyways, thanks.

                Comment

                • protist
                  Senior Member
                  • Jan 2009
                  • 101

                  Originally posted by tldgID View Post
                  Thanks protist! not sure what 'legacy Illumina adapters' are thought! and I couldn't find any information about them on Illumina website or customer letter. But anyways, thanks.
                  The original adapters (what I called legacy) released by Illumina are not exactly the same sequence as the currently in use TruSeq adapters - e.g. old adapters did not have indexes TruSeq ones do. The sequences for the individual TruSeq adapters can be found in the Illumina customer letter (see attached) which can also be downloaded from the Illumina website. I have also attached an alignment I had illustrating the differences between the original adapters and the currently in use TruSeq adapters.
                  Attached Files

                  Comment

                  • tldgID
                    Member
                    • May 2011
                    • 18

                    This is a great comparison protist! thank you!

                    Comment

                    • costamc
                      Junior Member
                      • Mar 2012
                      • 6

                      Hi,
                      I've been trying to sequence the V3-V4 region of the 16S gene was hoping touse my forward and reverse primers as my sequencing primers and the reverse compliment of the reverse primer as my index primer. The problem I just found during a real time PCR to determine sequencing primer efficiency is that the primers will not bind their targets efficiently at the required temperature (65oC).
                      We can easily increase the length of the sequencing primers going back into the Illumina adapters, but I am afraid that when I increase the length of the index primer I will end up out of the conservative region. I've tried including several degeneracies, but the lowest Tm is never higher than 65oC.
                      the reverse primer I choose is the S-D-Bact-0785-a-A-21: 5′-GACTACHVGGGTATCTAATCC-3

                      I appreciate any ideas or comments.

                      Marcio.

                      Comment

                      • mchikri
                        Junior Member
                        • Mar 2013
                        • 1

                        Hi
                        I m new and happy to be part of seqanswers
                        I hope to learne and to be also usful
                        mchikri

                        Comment

                        • bssharma
                          Junior Member
                          • Nov 2013
                          • 4

                          Insert length?

                          Can anyone plz tell mE what is the insert length (bp) (assuming adaptor length is 60bp on each end) for 350bp DNA fragment subjected to paired end sequencing.
                          THANKS!

                          Comment

                          • pmiguel
                            Senior Member
                            • Aug 2008
                            • 2328

                            Originally posted by bssharma View Post
                            Can anyone plz tell mE what is the insert length (bp) (assuming adaptor length is 60bp on each end) for 350bp DNA fragment subjected to paired end sequencing.
                            THANKS!
                            230 bp? (350 - (2 x 60))
                            Not entirely clear what you are asking, though. I am presuming by "350 bp DNA fragment" you mean, 350 bp amplicon.

                            --
                            Phillip
                            Last edited by pmiguel; 11-07-2013, 06:55 AM.

                            Comment

                            • bssharma
                              Junior Member
                              • Nov 2013
                              • 4

                              Hi, I think i got my answer, thanks. If you can also tell me in Illumina sequencing which sequencing read length format generates overlapping end? and how long is the overlapping region for 230bp insert?
                              Thank you so much

                              Comment

                              • bssharma
                                Junior Member
                                • Nov 2013
                                • 4

                                Originally posted by pmiguel View Post
                                230 bp? (350 - (2 x 60))
                                Not entirely clear what you are asking, though. I am presuming by "350 bp DNA fragment" you mean, 350 bp amplicon.
                                Hi, I think i got my answer, thanks. If you can also tell me in Illumina sequencing which sequencing read length format generates overlapping end? and how long is the overlapping region for 230bp insert?
                                Thank you so much

                                Comment

                                Latest Articles

                                Collapse

                                • seqadmin
                                  Pathogen Surveillance with Advanced Genomic Tools
                                  by seqadmin




                                  The COVID-19 pandemic highlighted the need for proactive pathogen surveillance systems. As ongoing threats like avian influenza and newly emerging infections continue to pose risks, researchers are working to improve how quickly and accurately pathogens can be identified and tracked. In a recent SEQanswers webinar, two experts discussed how next-generation sequencing (NGS) and machine learning are shaping efforts to monitor viral variation and trace the origins of infectious...
                                  Yesterday, 11:48 AM
                                • seqadmin
                                  New Genomics Tools and Methods Shared at AGBT 2025
                                  by seqadmin


                                  This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.

                                  The Headliner
                                  The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...
                                  03-03-2025, 01:39 PM
                                • seqadmin
                                  Investigating the Gut Microbiome Through Diet and Spatial Biology
                                  by seqadmin




                                  The human gut contains trillions of microorganisms that impact digestion, immune functions, and overall health1. Despite major breakthroughs, we’re only beginning to understand the full extent of the microbiome’s influence on health and disease. Advances in next-generation sequencing and spatial biology have opened new windows into this complex environment, yet many questions remain. This article highlights two recent studies exploring how diet influences microbial...
                                  02-24-2025, 06:31 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by seqadmin, 03-20-2025, 05:03 AM
                                0 responses
                                26 views
                                0 reactions
                                Last Post seqadmin  
                                Started by seqadmin, 03-19-2025, 07:27 AM
                                0 responses
                                33 views
                                0 reactions
                                Last Post seqadmin  
                                Started by seqadmin, 03-18-2025, 12:50 PM
                                0 responses
                                25 views
                                0 reactions
                                Last Post seqadmin  
                                Started by seqadmin, 03-03-2025, 01:15 PM
                                0 responses
                                190 views
                                0 reactions
                                Last Post seqadmin  
                                Working...