[kr067]

Thank you sci_guy! that was really helpful!

[sci_guy]

@kr067: No. Read the pdf posted by clpX above.

[kr067]

paired end seq

Hi all,
Im new to paired end mRNA seq. Are the adapters for the paired end seq same as the genomic DNA adapters?
Thanks

[jchoo]

thanks,thats what i want,by the way weather all the illumina use the same adapter?

[AdamB]

I found the answer in another thread. Just to check, I called Illumina tech support, and they have confirmed the stock PCR primer 1.1 and 2.1 concentration is 25 uM.

[AdamB]

Does anyone know the primer concentrations required for SE ChIP library preparation?

This is the information given in the protocol:

Prepare the following PCR reaction mix:
• DNA (36 μl)
• 5x Phusion* buffer (10 μl)
• dNTP mix (1.5 μl)
• PCR primer 1.1 (1 μl)
• PCR primer 2.1 (1 μl)
• Phusion* polymerase (0.5 μl)
The total volume should be 50 μl.

N.b. only 10 ng of DNA is used for the library preparation in the first place, so the primer concentrations might be lower than for whole genome DNA sequencing?

Thanks.

[cur]

Hi greigite
Thanks for the reply- in this case the answer was actually simple in the end- the sequencing service had not sent us the right data. Once we got the right data there was no problem with the alignment :-) what a relief

[clpX]

Re: Illumina Index PE adaptor

Hi jsilhavy,

the adapters are quite similar because the index is added in the PCR step and does not come with the adapters. I attach a file with the sequences that I found in some other post in this forum.

[jsilhavy]

Illumina Index PE adaptor

Hi,

I purchased Illumina's multiplexing kit and ligated the index PE adaptor to my samples. However, I soon learned that this kit is not compatible with Agilent's SureSelect DNA Capture protocol (microarray based). I would still like to proceed with the library prep (have not added the barcodes/indexes) but was wondering if anyone knew the difference between Illumina's Index PE adaptor and standard PE adaptors.

Thanks!!

[greigite]

Hi cur,

That is not quite right- you have to use the sequence of the PCR product produced by amplification of your library with paired end primers to identify sequences to screen out. You are looking for sequence between your insert and the flow cell oligo. This would appear in your product only if your insert was incredibly short (or nonexistent)- I suspect you may have sequenced a whole bunch of adapters. What did your Bioanalyzer trace look like? I've found that the molar ratio of amplified adapter sequence (~130 bp) to amplified library is pretty close to the percentage of adapter only reads you get.

I believe the following is right but others please correct if not:

Sequence between your insert and the flow cell oligo for Round 1 paired end:
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG

Sequence between your insert and the flow cell oligo for Round 2 paired end:
AGAAAGGGATGTGCTGCGAGAAGGCTAGA

For single read the appropriate sequence to screen out depends whether you prepped your libraries with single or paired end adapters.

[cur]

solexa adapter sequences for paired end data

Hi
I wonder if somebody can help me here....I have got some solexa data (paired end reads) and want to map these to the genome with bwa/maq...However when I did this only 20% of sequences mapped so I gather I want to check/ for presence of adapters in the sequences and then repeat the alignment after trimming of the data.

Which adapter sequences should I screen for- as this is paired end data I assume its the 5` to 3` sequence for the PE adpter 1 and 2 which I found in one of your posts?
Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'

In fasta format:
>Solexa-PairedEndAdapter1
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>SolexaPairedEndAdapter2
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

If I had single end solexa data would I then screen for the same adapters

Genomic DNA oligonucleotide sequences (from previous posting)
Adapters 1
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

[hheuven]

merging MAQ map files exceed limits

Dear all,

I have 45M (25M in pairs) aligned Solexa reads of 62 bp length in several map files after running Maq map. I have removed the duplicates and now I want to merge them, but get an error message that says that the size of the merged file becomes to big (> 2.1G). How I can get around this?

Are there scripts available that allow me to split the mapfiles according to chromosome number?


Kind regards
Henri Heuven
vet.fac.uu

[der_eiskern]

i can say the SE adaptors worked on my GAIIx SE sequencing runs last August with the latest kits at the time.

[bp79]

Thanks for all the helpful stuff on here. A quick newbie question: are all these adapter sequences etc definitely unchanged across the various incarnations of Illumina (GAI, IIe, IIx) - I think so but not certain?
Thanks
bp

[Samodha]

Hi,
I am New to Illumina sequencing. This is a great resource!!! I was wondering if anyone has figured out the sequences of the multiplexing adaptors.

Thanks