Announcement

Collapse
No announcement yet.

Illumina/Solexa Genome Analyzer Primer/Adapter Sequences

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Illumina/Solexa Genome Analyzer Primer/Adapter Sequences

    The following sequences were obtained from here (**):

    Sequences for Solexa Library Preparations:

    Genomic DNA oligonucleotide sequences

    Adapters 1
    5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
    5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

    PCR Primers 1
    5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT

    Genomic DNA Sequencing Primer
    5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT


    DpnII gene expression oligonucleotide sequences

    Gex Adapter 1
    5' P-GATCGTCGGACTGTAGAACTCTGAAC
    5’ ACAGGTTCAGAGTTCTACAGTCCGAC

    Gex Adapter 2
    5' CAAGCAGAAGACGGCATACGANN
    5' P-TCGTATGCCGTCTTCTGCTTG

    Gex PCR Primer 1
    5' CAAGCAGAAGACGGCATACGA

    Gex PCR Primer 2
    5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

    Gex Sequencing Primer
    5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

    NlaIII gene expression oligonucleotide sequences

    Gex Adapter 1
    5' P-TCGGACTGTAGAACTCTGAAC
    5' ACAGGTTCAGAGTTCTACAGTCCGACATG

    Gex Adapter 2
    5' CAAGCAGAAGACGGCATACGANN
    5' P-TCGTATGCCGTCTTCTGCTTG

    Gex PCR Primer 1
    5' CAAGCAGAAGACGGCATACGA

    Gex PCR Primer 2
    5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

    Gex Sequencing Primer
    5' CCGACAGGTTCAGAGTTCTACAGTCCGACATG


    Small RNA oligonucleotide sequences

    RT Primer
    5' CAAGCAGAAGACGGCATACGA

    5' RNA Adapter
    5' GUUCAGAGUUCUACAGUCCGACGAUC

    3' RNA Adapter
    5' P-UCGUAUGCCGUCUUCUGCUUGUidT

    Small RNA PCR Primer 1
    5' CAAGCAGAAGACGGCATACGA

    Small RNA PCR Primer 2
    5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

    Small RNA Sequencing Primer
    5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

    **disclaimer blah blah blah. We take no responsibility if you blow a flow cell using these sequences!

  • #2
    Bravo! Just what I needed.

    Comment


    • #3
      Very useful!
      I refined these sequences. Hopes they're clearer.


      Genomic DNA

      Adapter:
      5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
      3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------- 5'
      Adapter:
      5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3'
      3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
      PCR Primer:
      5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
      3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'
      PCR Primer:
      5' -------------------- -------------------- ------------------ (-) -------------------- -------------- 3'
      3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
      Result Library:
      5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3'
      3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
      Genomic DNA Sequencing Primer:
      5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
      3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'

      DpnII gene expression

      Gex Adapter 1:
      5' -------------------A CAGGTTCAGAGTTCTACAGT CCGAC--------------- -------------------- ------ 3'
      3' -------------------- ---CAAGTCTCAAGATGTCA GGCTGCTAGp---------- -------------------- ------ 5'
      Gex Adapter 2:
      5' -------------------- -------------------- -------------------- ----pTCGTATGCCGTCTTC TGCTTG 3'
      3' -------------------- -------------------- -------------------- ---NNAGCATACGGCAGAAG ACGAAC 5'
      Gex PCR Primer 1:
      5' -------------------- -------------------- ----------------------------------------- ------ 3'
      3' -------------------- -------------------- -------------------- -----AGCATACGGCAGAAG ACGAAC 5'
      Gex PCR Primer 2:
      5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA---------------- -------------------- ------ 3'
      3' -------------------- -------------------- -------------------- -------------------- ------ 5'
      Result Library:
      5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACGATCNNNNNNNNNNN NNNNNTCGTATGCCGTCTTC TGCTTG 3'
      3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGCTAGNNNNNNNNNNN NNNNNAGCATACGGCAGAAG ACGAAC 5'
      Gex Sequencing Primer:
      5' -----------------CGA CAGGTTCAGAGTTCTACAGT CCGACGATC----------- -------------------- ------ 3'
      3'--------------------- -------------------- -------------------- -------------------- ------ 5'

      NlaIII gene expression

      Gex Adapter 1:
      5' -------------------A CAGGTTCAGAGTTCTACAGT CCGACATG------------ -------------------- ------ 3'
      3' -------------------- ---CAAGTCTCAAGATGTCA GGCTp--------------- -------------------- ------ 5'
      Gex Adapter 2:
      5' -------------------- -------------------- -------------------- ----pTCGTATGCCGTCTTC TGCTTG 3'
      3' -------------------- -------------------- -------------------- ---NNAGCATACGGCAGAAG ACGAAC 5'
      Gex PCR Primer 1:
      5' -------------------- -------------------- -------------------- -------------------- ------ 3'
      3' -------------------- -------------------- -------------------- -----AGCATACGGCAGAAG ACGAAC 5'
      Gex PCR Primer 2:
      5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA---------------- -------------------- ------ 3'
      3' -------------------- -------------------- -------------------- -------------------- ------ 5'
      Result Library:
      5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACATGNNNNNNNNNNNN NNNNNTCGTATGCCGTCTTC TGCTTG 3'
      3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGTACNNNNNNNNNNNN NNNNNAGCATACGGCAGAAG ACGAAC 5'
      Gex Sequencing Primer:
      5' ----------------CCGA CAGGTTCAGAGTTCTACAGT CCGACATG------------ -------------------- ------ 3'
      3' -------------------- -------------------- -------------------- -------------------- ------ 5'

      Small RNA

      5' RNA Adapter:
      5' -------------------- ---GUUCAGAGUUCUACAGU CCGACGAUC (-) -------------------- - 3'
      3' -------------------- -------------------- --------- (-) -------------------- - 5'
      3' RNA Adapter:
      5' -------------------- -------------------- --------- (-)pUCGUAUGCCGUCUUCUGCUU GUidT 3'
      3' -------------------- -------------------- --------- (-) -------------------- - 5'
      RT Primer:
      5' -------------------- -------------------- --------- (-) -------------------- - 3'
      3' -------------------- -------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
      Small RNA PCR Primer 1:
      5' -------------------- -------------------- --------- (-) -------------------- - 3'
      3' -------------------- -------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
      Small RNA PCR Primer 2:
      5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA----- (-) -------------------- - 3'
      3' -------------------- -------------------- --------- (-) -------------------- - 5'
      Result Library:
      5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACGATC (N) TCGTATGCCGTCTTCTGCTT G 3'
      3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGCTAG (N) AGCATACGGCAGAAGACGAA C 5'
      Small RNA Sequencing Primer:
      5' -----------------CGA CAGGTTCAGAGTTCTACAGT CCGACGATC (-) -------------------- - 3'
      3' -------------------- -------------------- --------- (-) -------------------- - 5'


      Two errors have been corrected. (Genomic DNA Adapter & Small RNA Result Library)
      I'm sorry for that and other potential errors.
      Last edited by ECO; 10-03-2008, 05:34 AM. Reason: changed font to courier new

      Comment


      • #4
        Thanks Horigen! That definitely clarifies things!

        If anyone is having trouble viewing, make sure your browser is as wide as it can go.

        Comment


        • #5
          Hello,
          just one question.

          We want to synthesize the adapters by ourselves.
          Its necessary to phosphorylate the 5' end of the adapters additional?
          (there is still no 5' phosphate?)

          Thanks a lot!

          Comment


          • #6
            The P.E adaptors/primers have been added at the original link.

            Comment


            • #7
              Sorry for the small font, but that's the only way I could make it fit


              Paired-end DNA

              PE Adapter1:
              5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
              3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
              PE Adapter2:
              5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
              3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
              PE PCR Primer1:
              5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
              3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
              PE PCR Primer2:
              5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
              3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
              Result Library:
              5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
              3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
              PE DNA Sequencing Primer1
              5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
              3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
              PE DNA Sequencing Primer2
              5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
              3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'
              Last edited by dandestroy; 09-18-2008, 07:22 PM.

              Comment


              • #8
                Can someone explain to me why the Illumina adapters need to be 5´-phosphorylated? In the very similar SOLiD sample prep protocol the adapters are not phosphorylated.

                Comment


                • #9
                  Illumina adaptors need 5' phosphorylation for the ligation. The newer SOLiD protocol uses a "nick translation" like step where the "nick" left over from ligating primers without a 5'-phosphate is translated to (or near enough to) the primer terminus. One strand will ligate as there is a 5' phosphate on the end repaired template DNA. The SOLiD adaptors are blunt-ended on the termini designed for ligation, whereas the Illumina adaptors use a T overhang to create incompatible ends. If the SOLiD primers had 5' phosphate groups there would be a LOT of P1-P2, P1-P1 or P2-P2 ligated product; hence the nick translation like step. Nice clever twist.

                  Comment


                  • #10
                    What conditions do I use to anneal the adapters and what concentration is optimal for ligation of adapters to the fragmented genomic DNA. I am ordering the Illumina primers through Invitrogen. :
                    Last edited by swaroom; 10-06-2008, 07:43 AM.

                    Comment


                    • #11
                      mRNA-Seq adapter sequences?

                      The sequences above are really helpful. Does anyone also have the sequences for mRNA-Seq? This would be really great!!!

                      Comment


                      • #12
                        I use PE-adapter to mRNA-seq, it can work properly.

                        Comment


                        • #13
                          mRNA-seq adapters

                          Originally posted by Jenny Russ View Post
                          The sequences above are really helpful. Does anyone also have the sequences for mRNA-Seq? This would be really great!!!

                          mRNA-seq kit uses PE adaptors, and read 1 primer is same as genomic DNA primer for single read sequencing. If you have a PE sample ready, but whatever the reason wants single end sequencing, do that just like for SR sequencing. Done that many times.

                          Comment


                          • #14
                            Hello there,

                            first at all, i want to thank you to all to coperate to give us the sequence of the GEX 1 and 2 adapters and primers for the tag profilling with DpnII , but

                            does anybody know at which concentration are they used??? The Illumina protocol does not give concentrations. According to the Invitrogen LongSAGE protocol the double stranded adapters have a concentration of 40 ng/ul and 1.5 ul are used for one ligation reaction

                            thanks a lot,
                            BS

                            Comment


                            • #15
                              Hi all,

                              Thanks for the technical details on this. Anyone got some information about bioinformatics on adapter contamination detection and removal. I tried using adapter sequences with eland to check for contamination, but less than 1% reads aligned. I expected more as less than 10% reads aligned to actual reference.

                              I know of a file one can specify in GA pipeline, to exclude sequences -- could someone point more details on the same? (i tried bioinformatics thread, but did not hear back )

                              thanks!
                              --
                              bioinfosm

                              Comment

                              Working...
                              X