homemade barcode with degenerated 5' sequences?

[groad]

Hi everyone,

In order to reduce the library preparation cost, I am thinking of use my own barcode system by incorporating the 6bp barcodes at the 5' of forward primers. However, if I only have, say 4 samples, the base complexity would be rather low as I imagined. Therefore, I am posting out another of my thoughts for you to evaluate.

How about add extra 4 degenerated bases before the barcode? Each forward primer would look like this:
XXXX-GACTTA-forward primer
------
XXXX Degenerated bases
GACTTA one of the 6base barcodes

If this design would work, we should be able to pool as few as two samples for deep sequencing.

The price for primers with a few degenerated bases is the same as the regular primer.

Any comments?
Thanks.
Jim

[mcnelson.phd]

Hi Jim,

I assume that you're talking about amplicon sequencing? If I read you right, then you're sequencing through your 4N mix, then the barcode, and then the F primer? The 4N mix would create the even base distribution that the analysis software needs in order to properly set intensity thresholds and baselines. You would still have an immediate problem though during the barcode and more importantly the primer sequencing as the base composition would be too identical. If you're doing this on a MiSeq you have the added issue that the base composition per color channel needs to be even as well.

I'd be interested in hearing more about what you're trying to do exactly and how best to create primers to handle both low and high-plexity sequencing.

[MG1655]

Hi Jim,
That should work. I recently did a run where my design was

Universal Adapter Sequencing primer diversity clamp
AATGATACGGCGACCACCGAGATCTACAC TCaCTAGcatatgcgaagcagcatgacttct NNNNNN CAGGTTGATAATGACAAAC

For a published example, see Table 1 in the Supplementary Info of
http://aem.asm.org/content/77/11/3846.full.pdf+html

I chose IDT's standard machine mixing, which seems to work fine for generating sufficient diversity