Miseq FASTQ sequence identifier missing index read?

[GenoMax]

Would it not be simpler to replace the index numbers with the actual sequences?

[kmcarr]

It seems that index sequence is replaced by sample number...

Is there a way to make software print index sequences instead of sample number. What is the reason for this change. To make files smaller? Thank you.

Yes, they do report sample ID in place of the barcode. There is no way to alter this behavior in the MiSeq analysis software. If you want the files to match the output of the HiSeq you can run the MiSeq BCL files through CASAVA to create FASTQ files.

Why did they do this? Simply to be difficult I think.

[rnaeye]

Hi,
Recently, I have been using Miseq. I have noticed that fastq header is missing index read that Hiseq/GAII had it. For example:

@SIM:1:FCX:1:15:6329:1045 1:N:0:2
TCGCACTCAACGCCCTGCATATGACAAGACAGAATC
+
<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=

It seems that index sequence is replaced by sample number. When I ran 4 barcoded samples (indexes 4,6,8, and 12), I get something like followings:
1:N:0:1
1:N:0:2
1:N:0:3
1:N:0:4

Is there a way to make software print index sequences instead of sample number. What is the reason for this change. To make files smaller? Thank you.