HI, i am a pretty new for sequence analysis and totally new comer here. My questions might be too basic for you to answer but it will help me start my sequence analysis work with a good beginning. Anyone can help me? Very appreciate!!!
All I have are three fastq format separate raw data (each has more than 40 million read sequence) which are forward read data1, barcode read data2 and reverse read data 3. All of them three are corresponding each other from beginning with the same order. I used extra barcode file (6 different barcode) to split data 2 into 6 groups of different files (by galaxy barcode splitter). Now, I was stuck here and can't keep going until I figure out the following questions,
1. How can I sort the forward data1 and reverse data2 using my 6 files generated by barcode splitter. Is there software to do this? By the way, I do not have much bioinformatics background, any good suggestion?
2. How do I know where is the adapt sequences or if there are adapt sequences in the forward/reverse sequence from data 1 and 3 because this is very helpful for me to do adapt trim from original sequence?
following is just one example I extracted from my original data . All I have are only following 3 data with a separate barcode file. I do not have extra information like how is the barcode been designed, library construction or other..
Data 1 (forward read)
@IPAR1:2:1:4029:1196:1#0/1 ATTTTGCCACATACAAAAGAATCTACGTTCTTCTCAGCACCTCATGGAATCTTCTCTAAAATATATCATATAATAGGACACAAAAGAA
+ BHGHHHHHHHHGDDFHHHGGDGHFHFHHHHGD>GEEG>GFHHHHFHBBHFHHHHEHHHHHHBAFHHBBEHHHFEHGBECEHFHHFAHF
Data 2 (barcode read; TGACCTTG is the barcode tag and do not know yet what is ATCTCGT after tag)
@IPAR1:2:1:4029:1196:1#0/2
TGACCTTGATCTCGT
+
HIHIIGIIIH8CCDC
Data 3 (reverse read)
@IPAR1:2:1:4029:1196:1#0/3 GATATAATGGATGGGATTATTTCAATCTTTTATCTATTGAGGCTTCTTTTGTGTCCTATTATATGATATATTTTAGAGAAGATTCCAT
+ IIHIIIIHIIDEGGGEBG>GIIFIHHIHIIIIIFIDE4G@GG<GGEGBGG?AACCIIBIIBDIIIFDII>IIIIDIH@DFIGBI@IEE
All I have are three fastq format separate raw data (each has more than 40 million read sequence) which are forward read data1, barcode read data2 and reverse read data 3. All of them three are corresponding each other from beginning with the same order. I used extra barcode file (6 different barcode) to split data 2 into 6 groups of different files (by galaxy barcode splitter). Now, I was stuck here and can't keep going until I figure out the following questions,
1. How can I sort the forward data1 and reverse data2 using my 6 files generated by barcode splitter. Is there software to do this? By the way, I do not have much bioinformatics background, any good suggestion?
2. How do I know where is the adapt sequences or if there are adapt sequences in the forward/reverse sequence from data 1 and 3 because this is very helpful for me to do adapt trim from original sequence?
following is just one example I extracted from my original data . All I have are only following 3 data with a separate barcode file. I do not have extra information like how is the barcode been designed, library construction or other..
Data 1 (forward read)
@IPAR1:2:1:4029:1196:1#0/1 ATTTTGCCACATACAAAAGAATCTACGTTCTTCTCAGCACCTCATGGAATCTTCTCTAAAATATATCATATAATAGGACACAAAAGAA
+ BHGHHHHHHHHGDDFHHHGGDGHFHFHHHHGD>GEEG>GFHHHHFHBBHFHHHHEHHHHHHBAFHHBBEHHHFEHGBECEHFHHFAHF
Data 2 (barcode read; TGACCTTG is the barcode tag and do not know yet what is ATCTCGT after tag)
@IPAR1:2:1:4029:1196:1#0/2
TGACCTTGATCTCGT
+
HIHIIGIIIH8CCDC
Data 3 (reverse read)
@IPAR1:2:1:4029:1196:1#0/3 GATATAATGGATGGGATTATTTCAATCTTTTATCTATTGAGGCTTCTTTTGTGTCCTATTATATGATATATTTTAGAGAAGATTCCAT
+ IIHIIIIHIIDEGGGEBG>GIIFIHHIHIIIIIFIDE4G@GG<GGEGBGG?AACCIIBIIBDIIIFDII>IIIIDIH@DFIGBI@IEE