low complexity PCR amplicon sequencing using Miseq

[windhorse8]

Hi All,
I need to use Miseq for sequencing a pool of multiplexed PCR amplicons through in-house PCR amplicon preparation procedure (for various reasons) using custom-ordered adapters and primers. Based on the sequence information provided by Illumina, my PCR amplicons look like this:
(5' to 3', single strand shown here)
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT(NNNNNN)(INSERTSEQUENCE)AGATCGGAAGAGCACAGTCTGAACTCCAGTCACatcacgATCTCGTATGCCGTCTTCTGCTTG
where NNNNNN - a random hexamer sequence for each amplicon population (used to avoid low complexity problem)
insert sequence - somewhat homogeneous amplified sequence but not completely (50 - 150 bp in size)
lower case - One of Illumina index sequences
I am planning to pool together 20 samples, each with different N6, insert sequence, and Index sequence and sequence them as a single sample in Miseq. Can anyone help me with the possibility of sending this sample for Miseq or not ?
Thank you in advance.

windhorse

[frozenlyse]

I thought MiSeq basecalling could handle even single amplicons with the latest software updates?

[weigrc]

Hi all,

According the information below, 5% PhiX DNA spike-in can solve the problem of Low-Diversity Sequencing.


http://res.illumina.com/documents/pr...ersity_rta.pdf


BUT, for new MiSeq only~

[mcnelson.phd]

According the information below, 5% PhiX DNA spike-in can solve the problem of Low-Diversity Sequencing.

BUT, for new MiSeq only~

The 5% phiX value is a conservative value, you can easily drop that to 2% and your run will still work in most cases. If you're concerned, then do the 5% spike in and you'll be fine.

As for your other statements, there's only one MiSeq from a hardware perspective. All systems shipping now are compatible with all kits, and the older systems will have all been upgraded to handle version 2 and 3 kits as it was a free upgrade. There would be no excuse for anyone to be operating a MiSeq that would not be compatible with the version 2 kits.

For the software, that should also be up to date on all systems such that you shouldn't have to worry about that. Some places might not have upgraded to the latest software to be compatible with the version 3 kits, but they should still be up to date enough that the software correctly handles low-diversity libraries. If the instrument isn't that up to date, then I would have reservations about how well it has been maintained and probably wouldn't use it myself.