pindel analysis

[rashmijain]

Hi

I am working on PINDEL file, I am not sure what should be the criteria to filter pindel fie so that most of the false positives are removed.
what should be the value for AD/DP to get significant result?

Any help appreciated.

Thank you

[KaiYe]

Hi

I am working on PINDEL file, I am not sure what should be the criteria to filter pindel fie so that most of the false positives are removed.
what should be the value for AD/DP to get significant result?

Any help appreciated.

Thank you

you could use the number of reads supporting the ALT for filtering. If you have multiple samples, if one variant appears in multple samples, it is more likely to e true. you could also use variant allele frequency for filtering as well.

[rashmijain]

Thank you for the reply.
I have data in this format

Chr1 1000 . . PASS AC=5,1;AN=6;END=1073;HOMLEN=0;NTLEN=3;SF=1,2,11,19,36,43;SVLEN=73;SVTYPE=DUP:TANDEM GTP:AD . 1/.:27:3 2/.:16:4
Chr1 1002 . . PASS AC=3;AN=3;END=1064;HOMLEN=0;NTLEN=0;SF=0,13,29;SVLEN=62;SVTYPE=DUP:TANDEM GTP:AD 1/.:88:3 . .
Chr1 1064 . . PASS AC=10,22,2;AN=34;END=1064;HOMLEN=9;HOMSEQ=AAACCCTAA;SF=0,1,2,3,7,9,10,11,12,13,15,16,17,18,19,22,24,25,26,28,29,31,32,33,37,38,39,40,41,42,43,44,45,46;SVLEN=14;SVTYPE=INS GTP:AD 1/.:459:3 1/.:494:4 2/.:503:8
Chr1 1064 . . PASS AC=10;AN=10;END=1064;HOMLEN=9;HOMSEQ=AAACCCTAA;SF=0,1,9,13,16,28,29,31,42,45;SVLEN=34;SVTYPE=INS GTP:AD 1/.:459:6 1/.:494:11 .
Chr1 1090 . . PASS AC=17,1;AN=18;END=1090;HOMLEN=10;HOMSEQ=TAAACCCTAA;SF=0,1,2,3,5,6,10,12,16,19,22,23,24,33,36,43,44,46;SVLEN=27;SVTYPE=INS GTP:AD 1/.:478:4 1/.:511:3 1/.:532:3
Chr1 1090 . . PASS AC=1;AN=1;END=1090;HOMLEN=3;HOMSEQ=TAA;SF=0;SVLEN=47;SVTYPE=INS GTP:AD 1/.:478:4 . .
Chr1 20836 . . PASS AC=47;AN=47;END=20837;HOMLEN=9;HOMSEQ=AAAAAAAAA;SF=0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46;SVLEN=-1;SVTYPE=DEL GTP:AD 1/.:97:62 1/.:104:72 1/.:95:74
Chr1 23314 . . PASS AC=47;AN=47;END=23318;HOMLEN=56;HOMSEQ=TATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC;SF=0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46;SVLEN=-4;SVTYPE=DEL GTP:AD 1/.:78:15 1/.:72:15 1/.:78:18

I don't find any column with allele frequency. Do I need to calculate this myself?
Should I select only GT 1/. and AD/DP=?

I am new to do NGS analysis. I have tried to understand AD and DP by reading manual, but still not able to understand. It would be helpful if anybody can give me simple explanation for this.

Thank you

Rashmi