4C-seq with Truseq adapters on Nextseq500 problem

[Asashoryu]

I tried to do some 4C sequencing pilots on Nextseq500 platform. I've used these primers to finally amplify my library before sequencing:

AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCT | Truseq Reading adapter
CAAGCAGAAGACGGCATACGA | Non-reading adapter

these sequences are used by many people to do 4C libraries compatible with illumina.

amplification went well, qPCR test went OK (sequences necessary for cluster generation and sequencing primer is there), we size selected the library to remove all above 700bp...

Problem is that the run failed twice, with no clusters detected. Machine is OK, all runs before and after these samples were OK. technicians are very experienced, last months there were no runs failing due to their mistakes so expecting that they did something stupid just for these 2 runs is not very probable. PhiX spike in worked...

Can someone have a hint what went wrong?

[kcchan]

The NextSeq uses PE adapters on their flow cells. What you have listed are the older SR/Solexa adapters which only work on SR flow cells on the GA and HiSeq. You will need to modify your primers to include the PE adapter sequences before it can be sequenced on a NextSeq or MiSeq.

[Asashoryu]

Thanks for the reply! Indeed it makes sense now.

[ManuHdz]

Thanks for the reply! Indeed it makes sense now.

Hello!

I have been working on the same sort of experiments, first running on a GAIIx using the same PE adapters you mentioned for my 4C library prep worked well. Then we wanted to do our next runs on a NextSeq 500 but totally failed. I'd like to ask you, where you able to succeed using the new PE adapter sequences for the NextSeq? If so, would you mind sharing those sequences or where can I find them?
Good luck!

[Asashoryu]

Hello,

since I had the libraries ready, I sequenced them on HiSeq where they worked perfectly.

M

[ManuHdz]

Hello,

since I had the libraries ready, I sequenced them on HiSeq where they worked perfectly.

M

Okay, Thanks for your answer!

M

[tshashik]

Hi,

I'm having the same problems! I'm trying to sequence a 4C library on a NextSeq with the same adapter sequences you mentioned (the TruSeq adaptors) but the run failed. How can I modify the adaptor sequence to work on a NextSeq? And if I stick with the TruSeq sequence, will my library be sequenced on a HiSeq or GAIIx?

[ytak]

4C on nextseq500

The NextSeq uses PE adapters on their flow cells. What you have listed are the older SR/Solexa adapters which only work on SR flow cells on the GA and HiSeq. You will need to modify your primers to include the PE adapter sequences before it can be sequenced on a NextSeq or MiSeq.

I am trying sequence 4C libraries using Nextseq500 or Miseq. Where can I get information about PE primers which should be used especially for Nextseq500 or Miseq?
Is there anyone who sequenced 4C libraries using Nextseq500 or Miseq?

Thank you