Tweet
Hi all,
I'm interested in using the Nextera kit to do the fragmentation step for a TnSeq experiment but have some questions about the adaptor sequences.
For TnSeq, we would like to map the genomic insertion sites of a transposon in >50,000 strains. Traditionally, people have sheared the pooled genomic DNA, ligated an adaptor, and then PCR enriched for the transposon-genomic DNA junction.
We'd like to use Nextera for the shearing and ligation as we think it will be easier.
By combining the information from [1] and [2], I think that the Nextera kit adds the following sequences to the ends of the DNA:
AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
and
CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
The sequencing primers for reads 1 and 2 then bind to the ends of those sequences.
Are those details correct? The ends of the Nextera adaptors have about 19 nt (46C) of matching sequences.
For TnSeq, I would only use one of the supplied primers, and use a custom primer with the same tail and sequencing region but with a 3' that anneals to my transposon sequence (and no, my transposon is not the same as the Nextera one).
[1] http://journals.plos.org/plosone/art...e.0128036.s001
[2] http://supportres.illumina.com/docum...nce-letter.pdf
I'm interested in using the Nextera kit to do the fragmentation step for a TnSeq experiment but have some questions about the adaptor sequences.
For TnSeq, we would like to map the genomic insertion sites of a transposon in >50,000 strains. Traditionally, people have sheared the pooled genomic DNA, ligated an adaptor, and then PCR enriched for the transposon-genomic DNA junction.
We'd like to use Nextera for the shearing and ligation as we think it will be easier.
By combining the information from [1] and [2], I think that the Nextera kit adds the following sequences to the ends of the DNA:
AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
and
CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
The sequencing primers for reads 1 and 2 then bind to the ends of those sequences.
Are those details correct? The ends of the Nextera adaptors have about 19 nt (46C) of matching sequences.
For TnSeq, I would only use one of the supplied primers, and use a custom primer with the same tail and sequencing region but with a 3' that anneals to my transposon sequence (and no, my transposon is not the same as the Nextera one).
[1] http://journals.plos.org/plosone/art...e.0128036.s001
[2] http://supportres.illumina.com/docum...nce-letter.pdf