two adapters linked ?

[NicoBxl]

Hi everybody,

I'm actually analyzing microRNA data from an GAII sequencer. After trimming the adapter 3', I still found some reads with the adapter sequence. After looking in the raw reads ( before adapter trimming ) , I found reads with a sequence like that :

TCGTATGCCGTCTTCTGCTTGTTCGTATGCCGTCTTCTGCTTGT

The adapter in 3' is there, that's ok ! (here in green )

TCGTATGCCGTCTTCTGCTTGTTCGTATGCCGTCTTCTGCTTGT

but I see that the firts part of the read had the adapter sequence too ( here in red )

TCGTATGCCGTCTTCTGCTTGTTCGTATGCCGTCTTCTGCTTGT


So, Is it possible to have sequence like that ? with two adapters side to side ?

Thanks a lot for your answers,

Nicolas

[NicoBxl]

nobody has this problem ?

[mmartin]

I guess this doesn't help much, but I have seen that in 454 data (two years ago).

[scooter]

Typically the 3' adaptor is synthesized with a 3' end modification that should prevent ligation (e.g. 3' amine, 3' propyl, etc....) and therefore should limit the number of ligation events to one adaptor. To get multiple 3' adaptors in tandom the 3' end must not have been blocked on that molecule. I do not know the stats, but it is always possible that some (small) proportion of the population is accessible to ligation. I think even with pre-adenylated adaptors and ligation in the absence of ATP this type of reaction will occur at some level, but I would assume this type of tag is relatively rare in your samples. If not rare then I would perhaps be suspicious about the 3' adaptor.