Using TruSeq and Small RNA libraries in same sequencing reaction

[dlbuz]

I was wondering if it were possible to combine Small RNA libraries prepared using the Illumina Small RNA kit and mRNA libraries prepared using the TruSeq stranded mRNA kit into the same sequencing reaction?

I noticed that the PCR primer (RP1) used in the small RNA kit is similar up to 20ish nt from the 5' end of the TruSeq Universal Adapter.

RP1 (RNA PCR Primer) | After this point it differs from TruSeq Universal Adapter
5’ AATGATACGGCGACCACCGAGATCTACAC|GTTCAGAGTTCTACAGTCCGA

RPIX (Small RNA Index Primers)
5’ CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA

vs.


TruSeq Universal Adapter
5’ AATGATACGGCGACCACCGAGATCTACAC|TCTTTCCCTACACGACGCTCTTCCGATCT

TruSeq Index Adapters
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCCGTCTTCTGCTTG


Although the Small RNA and TruSeq individual adapters vary widely beginning from the 5' end.

I'm asking because I called Illumina support and they told me that they don't recommend it but didn't specifically say it would be incompatible. Knowing them they would want me to run 2 sequencing reactions separately.

[cmbetts]

It's probably fine on a MiSeq or NextSeq, as they automatically use all of the different sequencing primers for the different sample prep methods. I haven't done it with small RNA and TruSeq before, but we regularly mix TruSeq and Nextera libraries (And hybrids that have TruSeq on one end and Nextera on the other) on our MiSeqs/NextSeqs without any apparent issue.
I think that hardest part would be getting the cluster density right, as the different sized libraries have different clustering/loading characteristics. You also probably be wasting a lot of cycles on the smRNA library because of the read lengths and especially if you were planning on doing paired end.

[dlbuz]

I'm using MiSeq instrument and I was also under the impression that the instrument uses all the primers compatible with MiSeq.

One way I accounted for possible wasting cycles was to dilute the small RNA samples 10 fold as the coverage isn't as necessary as it is with the mRNA samples.

I was wondering if your reads came up normally with the illumina software platform when you used two different adapters or did you manually fish out the reads from the sequencing instrument?

[cmbetts]

I'm using MiSeq instrument and I was also under the impression that the instrument uses all the primers compatible with MiSeq.

One way I accounted for possible wasting cycles was to dilute the small RNA samples 10 fold as the coverage isn't as necessary as it is with the mRNA samples.

I was wondering if your reads came up normally with the illumina software platform when you used two different adapters or did you manually fish out the reads from the sequencing instrument?

The libraries will properly demultiplex as long as the sample sheet has the correct indices for the libraries. The requires manually editing the sample sheet because you can't select indices from multiple kits in Illumina Sample Manager. You would follow a similar procedure as if you've made your own custom indices.

[cmbetts]

I should also mention that when adding indices manually, there aren't any checks for correct color balancing, so it's up to you to make sure that they're compatible in low-plex situations.