Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • mitchum20
    Junior Member
    • Mar 2018
    • 6

    #1

    Filter for indels

    Dear all,

    I am looking at sequence data from a fungal microorganism strain mapped to an assembled reference genome sequence:
    Number of reads: 5.5 Mill Paired End
    Platform : Illumina HiSeq 2000
    Length read : 126 bp

    I want to retrieve the number of insertions / deletions between different strains and I applied BCFtools to list indels found with reasonable coverage in CDS regions. However, the identified indels are too many and not convincing as they include repetitions. (e.g. GCAACAGCAGCAACAGCAACAGCAGCAACA/GCA)

    Please also look at the attached IGV

    Do you know a way to filter meaningful indels? Which criteria would you apply?

    Best ; Tom
    Attached Files
    Last edited by mitchum20; 03-22-2018, 09:53 AM.

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM
  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 08-06-2026, 07:41 AM
0 responses
23 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-03-2026, 10:13 AM
0 responses
37 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-31-2026, 02:55 AM
0 responses
43 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-24-2026, 12:17 PM
0 responses
26 views
0 reactions
Last Post SEQadmin2  
Working...