Ion torrent flow order

[vnaveen]

Hi,

I have a doubt regarding the Ion torrent specific flow order.
why there should be a specific flow order ?

TACGTACGTCTGAGCATCGATCGATGTACAGC

rather than simple A T G C flow.

[IonTorrent]

Hi there,

This flow order is used to employ a degree of self-correction with respect to phase errors - i.e. loss of synchrony in template extension reactions during clonal amplification. There are some minor efficiency tradeoffs vs. a simple repeating order like you suggest, but there are big benefits with respect to accuracy and read length.

There's some discussion of this on a few blogs including Lex Nederbragt's: http://flxlexblog.wordpress.com/2011/07/01/going-with-the-flow-sequencing-flow-orders-and-longer-reads-ion-sets-the-stage/

That post links out to some related discussions on the Torrent Dev group of Ion Community if you'd like more information.