Header Leaderboard Ad

Collapse

Nugen multiplex library prep kit: anyone used it?

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Nugen multiplex library prep kit: anyone used it?

    I was wondering whether anyone out there has some experience with the Nugen library prep kit, think it's called "Encore NGS Library System for Ion Torrent" or something. http://tinyurl.com/9acgoo6

    My main interest is the barcoding adapters: looking at the sequences provided at the end of the user guide, it seems that their barcodes are shorter than the Ion Xpress kit (Life).

    Would be interesting to know if they simply replaced the barcode and kept the A/P1 adapters the same as those used in the Ion Xpress kit

    Any ideas from people experienced with this kit would be appreciated.

  • #2
    While the Encore Library System for Ion Torrent has unique barcode sequences, the resulting libraries will have flanking sequences that are compatible with the standard Ion Torrent sequencing primers. The resulting libraries will be the same as the Ion Torrent library product with the exception of the barcodes. (However, we would not recommend a direct 'swap' of adapters from another kit into the NuGEN system. The reason is that the adapters utilize a unique chemistry and are of a different design.)

    Cheers,
    Luke
    NuGEN Technologies

    Comment


    • #3
      thanks luke,

      reason I'm asking is that if I use your kit I'd like to know the adapter structure such as what is commonly known for example the Ion Xpress kit.
      e.g.
      5'CCATCTCATCCCTGCGTGTCTCCGACTCAGCTAAGGTAACGAT3'
      3'------------CGCACAGAGGCTGAGTCGATTCCATTGCTA5'


      So for example for the Ion Xpress kit my sequences will start with the following motif:
      TCAG[index of 10-12 bases]GAT[library sequence]

      So based on what you wrote can I assume that were I to use the nugen barcoding system my reads would start off something like this:
      TCAG[nugen index of 8 bases]GAT[library sequence]


      Details of this kind for your protocol would be very useful for deciding which kit to use.

      Also, it would be nice to know how many barcodes you offer. I have a kit manual (Encore® NGS Library Systems for
      Ion Torrent) which lists 16 barcoded adaptors (1-8 in part #307 and 9-16 in part #308). Are there any additional barcodes you offer?

      couldn't PM you for some reason...
      Last edited by van_nostram; 10-05-2012, 04:26 AM.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
        by seqadmin


        ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

        01-24-2023, 01:19 PM
      • seqadmin
        Introduction to Single-Cell Sequencing
        by seqadmin
        Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

        The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
        ...
        01-09-2023, 03:10 PM

      ad_right_rmr

      Collapse
      Working...
      X