Nugen multiplex library prep kit: anyone used it?

[van_nostram]

thanks luke,

reason I'm asking is that if I use your kit I'd like to know the adapter structure such as what is commonly known for example the Ion Xpress kit.
e.g.

5'CCATCTCATCCCTGCGTGTCTCCGACTCAGCTAAGGTAACGAT3'
3'------------CGCACAGAGGCTGAGTCGATTCCATTGCTA5'

So for example for the Ion Xpress kit my sequences will start with the following motif:
TCAG[index of 10-12 bases]GAT[library sequence]

So based on what you wrote can I assume that were I to use the nugen barcoding system my reads would start off something like this:
TCAG[nugen index of 8 bases]GAT[library sequence]


Details of this kind for your protocol would be very useful for deciding which kit to use.

Also, it would be nice to know how many barcodes you offer. I have a kit manual (Encore® NGS Library Systems for
Ion Torrent) which lists 16 barcoded adaptors (1-8 in part #307 and 9-16 in part #308). Are there any additional barcodes you offer?

couldn't PM you for some reason...

[lsherlin]

While the Encore Library System for Ion Torrent has unique barcode sequences, the resulting libraries will have flanking sequences that are compatible with the standard Ion Torrent sequencing primers. The resulting libraries will be the same as the Ion Torrent library product with the exception of the barcodes. (However, we would not recommend a direct 'swap' of adapters from another kit into the NuGEN system. The reason is that the adapters utilize a unique chemistry and are of a different design.)

Cheers,
Luke
NuGEN Technologies

[van_nostram]

I was wondering whether anyone out there has some experience with the Nugen library prep kit, think it's called "Encore NGS Library System for Ion Torrent" or something. http://tinyurl.com/9acgoo6

My main interest is the barcoding adapters: looking at the sequences provided at the end of the user guide, it seems that their barcodes are shorter than the Ion Xpress kit (Life).

Would be interesting to know if they simply replaced the barcode and kept the A/P1 adapters the same as those used in the Ion Xpress kit

Any ideas from people experienced with this kit would be appreciated.