reason I'm asking is that if I use your kit I'd like to know the adapter structure such as what is commonly known for example the Ion Xpress kit.
e.g.
5'CCATCTCATCCCTGCGTGTCTCCGACTCAGCTAAGGTAACGAT3'
3'------------CGCACAGAGGCTGAGTCGATTCCATTGCTA5'
3'------------CGCACAGAGGCTGAGTCGATTCCATTGCTA5'
So for example for the Ion Xpress kit my sequences will start with the following motif:
TCAG[index of 10-12 bases]GAT[library sequence]
So based on what you wrote can I assume that were I to use the nugen barcoding system my reads would start off something like this:
TCAG[nugen index of 8 bases]GAT[library sequence]
Details of this kind for your protocol would be very useful for deciding which kit to use.
Also, it would be nice to know how many barcodes you offer. I have a kit manual (Encore® NGS Library Systems for
Ion Torrent) which lists 16 barcoded adaptors (1-8 in part #307 and 9-16 in part #308). Are there any additional barcodes you offer?
couldn't PM you for some reason...
Leave a comment: