Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Adapters sequence for trimming PE reads

    Hi everyone,

    Recently I just received PEreads from BGI-seq, and the sequencer company provide me with this adapters index:
    i7_Index_ID i7index配列 i5_Index_ID i5index配列
    DNA Index i7ID i7Seq i5ID i5Seq
    SG-003 M5041/M7091 M7091 CAATCGTT M5041 CTGCGGAT
    SG-015 M5041/M7092 M7092 AGCCATAC M5041 CTGCGGAT
    SG-37 M5041/M7093 M7093 GTGATAGG M5041 CTGCGGAT
    SG-55 M5041/M7094 M7094 TCTGGCCA M5041 CTGCGGAT
    SG-77 M5041/M7101 M7101 TATGAACA M5041 CTGCGGAT
    .......etc.....

    So, I used those shrt sequences to trim my reads using trimmomatic in Galaxy, and prepared the fasta seq as follow for trimming:

    >index1/1
    GGTCCATT
    >index1/2
    TTAGGTAG
    >index2/1
    GGTCCATT
    >index2/2
    GGTCACTA
    >index3/1
    GGTCCATT
    >index3/2
    TCCGCACT
    ...etc...

    Did I use the information correctly? because recently I just found that others have been using:
    forward_adapter = "AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA"
    reverse_adapter = "AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG"

    to trim the adapters, not sure if its for SE only or also PE. Thank you

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
18 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
22 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
49 views
0 likes
Last Post seqadmin  
Working...
X