Adapters sequence for trimming PE reads

SEQanswers June Challenge Has Begun!

The competition has begun! We're giving away a $50 Amazon gift card to the member who answers the most questions on our site during the month. We want to encourage our community members to share their knowledge and help each other out by answering questions related to sequencing technologies, genomics, and bioinformatics. The competition is open to all members of the site, and the winner will be announced at the beginning of July. Best of luck!

For a list of the official rules, visit (https://www.seqanswers.com/forum/sit...wledge-and-win)

See less

uzi_maruzi

Junior Member

Join Date: Nov 2022
Posts: 4

Adapters sequence for trimming PE reads

11-10-2022, 01:32 PM

Hi everyone,

Recently I just received PEreads from BGI-seq, and the sequencer company provide me with this adapters index:

		i7_Index_ID	i7index配列	i5_Index_ID	i5index配列
DNA	Index	i7ID	i7Seq	i5ID	i5Seq
SG-003	M5041/M7091	M7091	CAATCGTT	M5041	CTGCGGAT
SG-015	M5041/M7092	M7092	AGCCATAC	M5041	CTGCGGAT
SG-37	M5041/M7093	M7093	GTGATAGG	M5041	CTGCGGAT
SG-55	M5041/M7094	M7094	TCTGGCCA	M5041	CTGCGGAT
SG-77	M5041/M7101	M7101	TATGAACA	M5041	CTGCGGAT

.......etc.....

So, I used those shrt sequences to trim my reads using trimmomatic in Galaxy, and prepared the fasta seq as follow for trimming:

>index1/1
GGTCCATT
>index1/2
TTAGGTAG
>index2/1
GGTCCATT
>index2/2
GGTCACTA
>index3/1
GGTCCATT
>index3/2
TCCGCACT
...etc...

Did I use the information correctly? because recently I just found that others have been using:
forward_adapter = "AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA"
reverse_adapter = "AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG"

to trim the adapters, not sure if its for SE only or also PE. Thank you

Tags: None

Previous template Next

A Review of Next-Generation Sequencing Methods for Studying Epigenetics—Part 2

by seqadmin

In the first segment of our review of epigenetic sequencing methods, we covered methylation detection, chromatin accessibility, and protein-DNA interactions. This final part of our review will break outside of the standard analysis and cover some influential multidimensional methods.

Spatial Epigenomics
“Epigenetic assays, whether conducted at the single-cell or bulk level, have played a crucial role in unraveling the underlying mechanisms of diseases and...
- Channel: Articles
Yesterday, 06:48 AM
A Review of Next-Generation Sequencing Methods for Studying Epigenetics—Part 1

by seqadmin

Developments in sequencing technologies and methodologies have transformed the field of epigenetics, giving researchers a better way to understand the complex world of gene regulation and heritable modifications. This article explores some of the diverse sequencing methods employed in the study of epigenetics, ranging from classic techniques to cutting-edge innovations while providing a brief overview of their processes, applications, and advances.

Methylation Detect...
- Channel: Articles
05-31-2023, 10:46 AM
Differential Expression and Data Visualization: Recommended Tools for Next-Level Sequencing Analysis

by seqadmin

After covering QC and alignment tools in the first segment and variant analysis and genome assembly in the second segment, we’re wrapping up with a discussion about tools for differential gene expression analysis and data visualization. In this article, we include recommendations from the following experts: Dr. Mark Ziemann, Senior Lecturer in Biotechnology and Bioinformatics, Deakin University; Dr. Medhat Mahmoud Postdoctoral Research Fellow at Baylor College of Medicine;...
- Channel: Articles
05-23-2023, 12:26 PM

Topics	Statistics	Last Post
Investigating the Genetics of the Human Vocal System by seqadmin Started by seqadmin, Yesterday, 10:20 AM	0 responses 8 views 0 likes	Last Post by seqadmin Yesterday, 10:20 AM
Analysis of West Nile Virus Explores Transmission Dynamics in Animal Species by seqadmin Started by seqadmin, 06-07-2023, 07:14 AM	0 responses 13 views 0 likes	Last Post by seqadmin 06-07-2023, 07:14 AM
BabySeq Project: Unveiling Medically Actionable Variants by seqadmin Started by seqadmin, 06-06-2023, 01:08 PM	0 responses 13 views 0 likes	Last Post by seqadmin 06-06-2023, 01:08 PM
Genetic Discoveries Transform Our Understanding of Primate Diversity and Behavior by seqadmin Started by seqadmin, 06-01-2023, 08:56 PM	0 responses 166 views 0 likes	Last Post by seqadmin 06-01-2023, 08:56 PM

Header Leaderboard Ad

Adapters sequence for trimming PE reads

Announcement

SEQanswers June Challenge Has Begun!

Adapters sequence for trimming PE reads

Latest Articles

ad_right_rmr

News