Header Leaderboard Ad

Collapse

Adapters sequence for trimming PE reads

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Adapters sequence for trimming PE reads

    Hi everyone,

    Recently I just received PEreads from BGI-seq, and the sequencer company provide me with this adapters index:
    i7_Index_ID i7index配列 i5_Index_ID i5index配列
    DNA Index i7ID i7Seq i5ID i5Seq
    SG-003 M5041/M7091 M7091 CAATCGTT M5041 CTGCGGAT
    SG-015 M5041/M7092 M7092 AGCCATAC M5041 CTGCGGAT
    SG-37 M5041/M7093 M7093 GTGATAGG M5041 CTGCGGAT
    SG-55 M5041/M7094 M7094 TCTGGCCA M5041 CTGCGGAT
    SG-77 M5041/M7101 M7101 TATGAACA M5041 CTGCGGAT
    .......etc.....

    So, I used those shrt sequences to trim my reads using trimmomatic in Galaxy, and prepared the fasta seq as follow for trimming:

    >index1/1
    GGTCCATT
    >index1/2
    TTAGGTAG
    >index2/1
    GGTCCATT
    >index2/2
    GGTCACTA
    >index3/1
    GGTCCATT
    >index3/2
    TCCGCACT
    ...etc...

    Did I use the information correctly? because recently I just found that others have been using:
    forward_adapter = "AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA"
    reverse_adapter = "AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG"

    to trim the adapters, not sure if its for SE only or also PE. Thank you
Working...
X