Header Leaderboard Ad

Collapse

Adapters sequence for trimming PE reads

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Adapters sequence for trimming PE reads

    Hi everyone,

    Recently I just received PEreads from BGI-seq, and the sequencer company provide me with this adapters index:
    i7_Index_ID i7index配列 i5_Index_ID i5index配列
    DNA Index i7ID i7Seq i5ID i5Seq
    SG-003 M5041/M7091 M7091 CAATCGTT M5041 CTGCGGAT
    SG-015 M5041/M7092 M7092 AGCCATAC M5041 CTGCGGAT
    SG-37 M5041/M7093 M7093 GTGATAGG M5041 CTGCGGAT
    SG-55 M5041/M7094 M7094 TCTGGCCA M5041 CTGCGGAT
    SG-77 M5041/M7101 M7101 TATGAACA M5041 CTGCGGAT
    .......etc.....

    So, I used those shrt sequences to trim my reads using trimmomatic in Galaxy, and prepared the fasta seq as follow for trimming:

    >index1/1
    GGTCCATT
    >index1/2
    TTAGGTAG
    >index2/1
    GGTCCATT
    >index2/2
    GGTCACTA
    >index3/1
    GGTCCATT
    >index3/2
    TCCGCACT
    ...etc...

    Did I use the information correctly? because recently I just found that others have been using:
    forward_adapter = "AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA"
    reverse_adapter = "AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG"

    to trim the adapters, not sure if its for SE only or also PE. Thank you

Latest Articles

Collapse

  • seqadmin
    A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
    by seqadmin


    ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

    01-24-2023, 01:19 PM
  • seqadmin
    Introduction to Single-Cell Sequencing
    by seqadmin
    Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

    The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
    ...
    01-09-2023, 03:10 PM

ad_right_rmr

Collapse
Working...
X