Tweet
Hi everyone,
I am mapping 36bp Illumina reads to a reference genome using BWA. When I convert my SAM output to BAM format with SAMTOOLS VIEW I get the following stderr:
[samopen] SAM header is present: 6 sequences.
Parse error at line 9: missing colon in auxiliary data
Line 9 of my SAM file looks like:
SRR029811.3|Run1_1_1_483:1065|length=36 16 Supercontig_3.5_of_Coccidioides_immitis_RS 29668 0 36M * 0 0 TTTCGCTGTCAATTTTTACCATCGTCAATTTTGGTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:R NM:i:1 X0:i:2 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:4A31 XA:Z:
Note the "XA:Z:" tag, which is missing a number at the end (?).
My commands:
bwa aln -f data.sai genome.fasta data.fastq
bwa samse -f data.sam genome.fasta data.sai data.fastq
samtools view -bS data.sam > data.bam
I thought I could do a work around to this problem by using the -n1 option in BWA SAMSE so that the XA tag will never be printed.
Does anyone have a better idea?
Thanks,
Sarah
I am mapping 36bp Illumina reads to a reference genome using BWA. When I convert my SAM output to BAM format with SAMTOOLS VIEW I get the following stderr:
[samopen] SAM header is present: 6 sequences.
Parse error at line 9: missing colon in auxiliary data
Line 9 of my SAM file looks like:
SRR029811.3|Run1_1_1_483:1065|length=36 16 Supercontig_3.5_of_Coccidioides_immitis_RS 29668 0 36M * 0 0 TTTCGCTGTCAATTTTTACCATCGTCAATTTTGGTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:R NM:i:1 X0:i:2 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:4A31 XA:Z:
Note the "XA:Z:" tag, which is missing a number at the end (?).
My commands:
bwa aln -f data.sai genome.fasta data.fastq
bwa samse -f data.sam genome.fasta data.sai data.fastq
samtools view -bS data.sam > data.bam
I thought I could do a work around to this problem by using the -n1 option in BWA SAMSE so that the XA tag will never be printed.
Does anyone have a better idea?
Thanks,
Sarah