Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • gaffa
    replied
    I'm not an expert on exome sequencing but from what I gather you should probably always align reads to the whole genome, not only to the regions on your capture array. However this is for general conceptual reasons, I don't know what's going on with your particular files.

    There has been some discussion of this on Biostar:

    We make Stack Overflow and 170+ other community-powered Q&A sites.

    Leave a comment:


  • HSG_student1
    started a topic Appropriate Reference Format

    Appropriate Reference Format

    Hello,

    I am trying to deal with some targeted resequencing data. I have a subset of hg19 that I targeted with a SureSelect Capture array and now have some Illumina HiSeq data on it. I aligned the reads to my .fasta formatted reference with Novoalign. The reference was downloaded from UCSC as exonic regions of known transcripts. An example is below. I am not aligning to all of h19 because I just want to see the alignments to the targeted regions. Do I need to align to the whole genome instead?

    >hg19_ct_UserTrack_3545_hg19_knownGene_uc001cyp.2_8 range=chr1:57409309-57409587 5'pad=30 3'pad=30 strand=- repeatMasking=none
    AACAGGGCTAGGCCTCTGGACTCGATCATAGGAAAAGGGACAGAGTGAAC
    TACCTTTTACGTCATGGACCTTTTTCCTTGTTTTCTTCAGATTATACTCT
    TAACAACGTCCATGCCTGTGCCAAAAATGATTTTAAAATTGGTGGTGCCA
    TTGAAGAGGTCTACGTCAGTCTGGGTGTGTCTGTAGGCAAATGCAGAGGT
    ATTCTGAATGAAATAAAAGGTGAGTGACAGGGGCTTGTGACTTCCACACT
    TATAATGTTTATCCTCCTAGTGCCTCTGG
    >hg19_ct_UserTrack_3545_hg19_knownGene_uc001aru.2_11 range=chr1:11086521-11087795 5'pad=30 3'pad=30 strand=- repeatMasking=none
    TCAAATATATACTTCAAGGCGGTCATAATTTAAGAAAAACACGATTGACA
    TTTTTACAAAGGCTCTCTACCTATCTGCTTCTTTCTCCAGTTTGTGGACT
    ATCAGCCCGCACAACAGGAGGGCGTATATATGGAGGGCAAAAGGCAAAAC

    The reads align fine using the above reference file in NovoAlign and I was able to make a .bam file with samtools and sort it in anticipation of making a bedGraph or Wiggle file using BEDTools. However, the headers used in my reference .fasta file do not seem to be compatible with the hg19.genome file that comes with BEDTools (a few lines are posted here):

    chr1 249250621
    chr2 243199373
    chr3 198022430
    chr4 191154276.

    Any advice if I should redownload my targeted reference sequence in a different format? Or parse to contain some different header format, for example:
    >chr1 start:xxxxxxx end:xxxxxx

    I have found lots of great help for ways to manipulate the files, but can't seem to conquer this most basic step.

    Thanks alot,
    Mike

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
179 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-06-2024, 08:18 AM
0 responses
223 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-06-2024, 08:04 AM
0 responses
184 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-03-2024, 06:55 AM
0 responses
18 views
0 likes
Last Post seqadmin  
Working...
X