Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Appropriate Reference Format

    Hello,

    I am trying to deal with some targeted resequencing data. I have a subset of hg19 that I targeted with a SureSelect Capture array and now have some Illumina HiSeq data on it. I aligned the reads to my .fasta formatted reference with Novoalign. The reference was downloaded from UCSC as exonic regions of known transcripts. An example is below. I am not aligning to all of h19 because I just want to see the alignments to the targeted regions. Do I need to align to the whole genome instead?

    >hg19_ct_UserTrack_3545_hg19_knownGene_uc001cyp.2_8 range=chr1:57409309-57409587 5'pad=30 3'pad=30 strand=- repeatMasking=none
    AACAGGGCTAGGCCTCTGGACTCGATCATAGGAAAAGGGACAGAGTGAAC
    TACCTTTTACGTCATGGACCTTTTTCCTTGTTTTCTTCAGATTATACTCT
    TAACAACGTCCATGCCTGTGCCAAAAATGATTTTAAAATTGGTGGTGCCA
    TTGAAGAGGTCTACGTCAGTCTGGGTGTGTCTGTAGGCAAATGCAGAGGT
    ATTCTGAATGAAATAAAAGGTGAGTGACAGGGGCTTGTGACTTCCACACT
    TATAATGTTTATCCTCCTAGTGCCTCTGG
    >hg19_ct_UserTrack_3545_hg19_knownGene_uc001aru.2_11 range=chr1:11086521-11087795 5'pad=30 3'pad=30 strand=- repeatMasking=none
    TCAAATATATACTTCAAGGCGGTCATAATTTAAGAAAAACACGATTGACA
    TTTTTACAAAGGCTCTCTACCTATCTGCTTCTTTCTCCAGTTTGTGGACT
    ATCAGCCCGCACAACAGGAGGGCGTATATATGGAGGGCAAAAGGCAAAAC

    The reads align fine using the above reference file in NovoAlign and I was able to make a .bam file with samtools and sort it in anticipation of making a bedGraph or Wiggle file using BEDTools. However, the headers used in my reference .fasta file do not seem to be compatible with the hg19.genome file that comes with BEDTools (a few lines are posted here):

    chr1 249250621
    chr2 243199373
    chr3 198022430
    chr4 191154276.

    Any advice if I should redownload my targeted reference sequence in a different format? Or parse to contain some different header format, for example:
    >chr1 start:xxxxxxx end:xxxxxx

    I have found lots of great help for ways to manipulate the files, but can't seem to conquer this most basic step.

    Thanks alot,
    Mike

  • #2
    I'm not an expert on exome sequencing but from what I gather you should probably always align reads to the whole genome, not only to the regions on your capture array. However this is for general conceptual reasons, I don't know what's going on with your particular files.

    There has been some discussion of this on Biostar:

    We make Stack Overflow and 170+ other community-powered Q&A sites.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM
    • seqadmin
      Strategies for Sequencing Challenging Samples
      by seqadmin


      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
      03-22-2024, 06:39 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    19 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    22 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 09:21 AM
    0 responses
    17 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-04-2024, 09:00 AM
    0 responses
    49 views
    0 likes
    Last Post seqadmin  
    Working...
    X